Introduction
Advantages of the BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit
Using the BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit for vector-based expression of shRNA provides the following advantages:
- Provides a rapid and efficient way to clone double-stranded oligonucleotide (ds oligo) duplexes encoding a desired shRNA target sequence into an entry vector containing an RNA Polymerase III (Pol III)-driven expression cassette (i.e. H1/TO RNAi cassette) for use in RNAi analysis.
- The entry construct containing the H1/TO RNAi expression cassette may be directly transfected into mammalian cells expressing the Tet repressor to enable rapid, tetracycline-regulated screening of shRNA target sequences.
- The entry construct contains a Zeocin™ resistance marker to allow generation of stable cell lines that express the shRNA of interest upon tetracycline addition.
- The vector is Gateway®-adapted to allow easy transfer of the H1/TO RNAi cassette into any appropriate expression system for other RNAi applications (e.g. lentiviral system for stable delivery of regulated shRNA in hard-to-transfect or non-dividing mammalian cells).
BLOCK-iT™ RNAi Technology
A variety of BLOCK-iT™ RNAi products are available from Invitrogen to facilitate RNAi analysis in mammalian and invertebrate systems. The BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit and the BLOCK-iT™ U6 RNAi Entry Vector Kit (Catalog nos. K4920-00 and K4945-00, respectively) use a vector-based approach to allow efficient generation of RNAi cassettes for constitutive or regulated expression of shRNA molecules in mammalian cells. Other BLOCK-iT™ RNAi products are available to facilitate production and delivery of synthetic short interfering RNA (siRNA), diced siRNA (d-siRNA) or double-stranded RNA (dsRNA) for RNAi analysis in mammalian cells or invertebrate organisms, as appropriate. For more information about any of the BLOCK-iT™ RNAi products, see the RNAi Central application portal at www.invitrogen.com/rnai or contact Technical Service
The T-REx™ Technology
The T-REx™ Technology facilitates tetracycline-regulated expression of a gene of interest in mammalian cells through the use of regulatory elements from the E. coli Tn10-encoded tetracycline (Tet) resistance operon (Hillen and Berens, 1994; Hillen et al., 1983). Tetracycline regulation in the T-REx™ System is based on the binding of tetracycline to the Tet repressor and derepression of the promoter controlling expression of the gene of interest (Yao et al., 1998). The main components of the T-REx™ System include:
- An inducible expression construct to facilitate tetracycline-regulated expression of your gene of interest under the control of a hybrid promoter containing two tetracycline operator 2 (TetO2) sites.
- A regulatory expression construct that facilitates high-level, constitutive expression of the Tet repressor (TetR). In the T-REx™ System, expression of the TetR gene is controlled by the CMV promoter.
- Tetracycline for inducing expression.
When the inducible expression construct and the regulatory expression construct are present in the same mammalian cell, expression of your gene of interest is repressed in the absence of tetracycline and induced in its presence (Yao et al., 1998).
Gateway® Technology
The Gateway® Technology is a universal cloning method that takes advantage of the site-specific recombination properties of bacteriophage lambda (Landy, 1989) to provide a rapid and highly efficient way to move your DNA sequence of interest (e.g. H1/TO RNAi cassette) into multiple vector systems. To express your shRNA of interest using the pENTR™/H1/TO vector, simply:
- Clone your ds oligo encoding the shRNA of interest into the pENTR™/H1/TO vector to generate an entry clone.
- Choose one of the following options:
- Transfect your entry construct into Tet repressor (TetR)-expressing mammalian cells. Add tetracycline to transiently assay for target gene knockdown.
- Transfect the entry construct into TetR-expressing mammalian cells and use Zeocin™ selection to generate a stable cell line. Add tetracycline to assay for target gene knockdown.
- Perform an LR recombination reaction between the entry construct and a suitable Gateway® destination vector to generate an expression clone for use in other RNAi applications.
For more information about the Gateway® Technology, refer to the Gateway® Technology with Clonase™ II manual which is available for downloading from our Web site (www.invitrogen.com) or by calling Technical Service.
Materials
Note: The BLOCK-iT™ Inducible H1 Lentiviral RNAi System also contains the BLOCK-iT™ Inducible H1 Lentiviral RNAi System components and the BLOCK-iT™ Inducible H1 Lentiviral RNAi System manual.
Component | Catalog no. | |
K4920-00 | K4925-00 | |
BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit | X | X |
BLOCK-iT™ Inducible H1 Lentiviral RNAi Reagents | X | |
Kit Components
The BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit and the BLOCK-iT™ Inducible H1 Lentiviral RNAi System include the following components. For a detailed description of the contents of the BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit, see below. For a detailed description of the contents of the BLOCK-iT™ Inducible H1 Lentiviral RNAi reagents, see the BLOCK-iT™ Inducible H1 Lentiviral RNAi System manual.
Shipping/Storage
The BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit and the BLOCK-iT™ Inducible H1 Lentiviral RNAi System are shipped as described below. Upon receipt, store each item as detailed below. For more detailed information about the BLOCK-iT™ Inducible H1 Lentiviral RNAi reagents supplied with the kit, refer to the BLOCK-iT™ Inducible H1 Lentiviral RNAi System manual.
Box | Component | Shipping | Storage |
1 | Inducible H1 RNAi Entry Vector Reagents and Tetracycline | Dry ice | Tetracycline: -20° C, protected from light All other reagents: -20° C |
2 | One Shot® TOP10 Chemically Competent E. coli | Dry ice | -80° C |
3-9 | BLOCK-iT™ Inducible H1 Lentiviral RNAi Reagents | Various | Various (refer to the BLOCK-iT™ Inducible H1 Lentiviral RNAi System manual for details) |
Inducible H1 RNAi Entry Vector Reagents and Tetracycline
The following reagents are included with the Inducible H1 RNAi Entry Vector and Tetracycline box (Box 1). Store the tetracycline at -20 ° C, protected from light. Store the other reagents at -20 ° C.
Reagent | Composition | Amount |
pENTR™/H1/TO vector, linearized | 0.75 ng/µl plasmid DNA in: 10 mM Tris-HCl, pH 8.0 1 mM EDTA, pH 8.0 | 4 x 10 µl |
10X Oligo Annealing Buffer | 100 mM Tris-HCl, pH 8.0 10 mM EDTA, pH 8.0 1 M NaCl | 250 µl |
DNase/RNase-Free Water | -- | 3 x 1.5 ml |
5X Ligation Buffer | 250 mM Tris-HCl, pH 7.6 50 mM MgCl2 5 mM ATP 5 mM DTT 25% (w/v) polyethylene glycol-8000 | 80 µl |
T4 DNA Ligase | 1 (Weiss) U/µl in 10 mM Tris-HCl, pH 7.5 50 mM KCl 1 mM DTT 50% (v/v) glycerol | 20 µl |
H1 Forward Sequencing Primer | 100 ng/µl in TE Buffer, pH 8.0 | 20 µl |
M13 Reverse Primer | 100 ng/µl in TE Buffer, pH 8.0 | 20 µl |
LacZ2.1 double-stranded (ds) Control Oligo | 5 nM in 1X Oligo Annealing Buffer | 50 µl |
pcDNA™1.2/V5-GW/lacZ control plasmid | Lyophilized in TE Buffer, pH 8.0 | 10 µg |
Tetracycline | 10 mg/ml in water | 1 ml |
Unit Definition of T4 DNA Ligase
One (Weiss) unit of T4 DNA Ligase catalyzes the exchange of 1 nmol 32P-labeled pyrophosphate into [λ/β-32P]ATP in 20 minutes at 37 ° C (Weiss et al., 1968). One unit is equal to approximately 300 cohesive-end ligation units.
Primer Sequences
The table below provides the sequence and the amount supplied of the primers included in the kit.
Primer | Sequence | Amount |
H1 Forward | 5'-tgttctgggaaatcaccata-3' | 328 pmoles |
M13 Reverse | 5' -caggaaacagctatgac -3' | 385 pmoles |
LacZ2.1 Control Oligo Sequences
The sequences of the lacZ2.1 control oligos are listed below. The lacZ2.1 control DNA oligos are annealed and are supplied in the kit as a 5 nM double-stranded oligo that is ready-to-use in the ligation reaction
LacZ2.1 DNA Oligo | Sequence |
Top strand | 5'- CACCAAATCGCTGATTTGTGTAGTCGGAGACGACTACACAAATCAGCGA -3' |
Bottom strand | 5' - AAAATCGCTGATTTGTGTAGTCGTCTCCGACTACACAAATCAGCGATTT -3' |
One Shot® TOP10 Reagents
The following reagents are included in the One Shot® TOP10 Chemically Competent E. coli kit (Box 2). Transformation efficiency is > 1 x 109 cfu/µg plasmid DNA. Store at -80° C.
Reagent | Composition | Amount |
S.O.C. Medium (may be stored at +4° C or room temperature) | 2% Tryptone 0.5% Yeast Extract 10 mM NaCl 2.5 mM KCl 10 mM MgCl2 10 mM MgSO4 20 mM glucose | 6 ml |
TOP10 cells | -- | 21 x 50 µl |
pUC19 Control DNA | 10 pg/µl in 5 mM Tris-HCl, 0.5 mM EDTA, pH 8 | 50 µl |
Experimental Outline
Flow Chart
The figure below illustrates the major steps necessary to produce a pENTR™/H1/TO entry clone using the BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit.
Designing the Single-Stranded DNA Oligos
Introduction
To use the BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit, you will first need to design two single-stranded DNA oligonucleotides; one encoding the target shRNA (“top strand” oligo) and the other its complement (“bottom strand” oligo). You will then anneal the top and bottom strand oligos to generate a double-stranded oligonucleotide (ds oligo) suitable for cloning into the pENTR™/H1/TO vector.
The design of the single-stranded oligonucleotides (ss oligos) is critical to the success of both the cloning procedure and ultimately, the RNAi analysis. General guidelines are provided in this section to help you choose the target sequence and to design the ss oligos. Note however, that simply following these guidelines does not guarantee that the shRNA will be effective in knocking down the target gene. For a given target gene, you may need to generate and screen multiple shRNA sequences to identify one that is active in gene knockdown studies.
Recommendation
We recommend using Invitrogen’s RNAi Designer, an online tool to help you design and order shRNA sequences for any target gene of interest. The RNAi Designer incorporates the guidelines provided in this manual as well as other design rules into a proprietary algorithm to design shRNA sequences from a target sequence that are compatible for use in cloning into the pENTR™/H1/TO or pENTR™/U6 vectors. Alternatively, if you have identified a synthetic siRNA that is active in triggering knockdown of your target gene, the RNAi Designer will convert the siRNA into a suitable shRNA. To use the RNAi Designer, see www.invitrogen.com/rnai.
Factors to Consider
When designing the top and bottom strand single-stranded oligos, consider the following factors:
Top strand oligo
- Sequences required to facilitate directional cloning
- Transcription initiation site
- Sequences encoding the shRNA of interest (i.e. stem and loop sequences)
Bottom strand oligo
- Sequences required to facilitate directional cloning
- Sequences complementary to the top strand oligo
For more information about the sequence requirements for directional cloning, see below. For guidelines to choose the target, loop, and transcription initiation sequences, see below. For an example of ss oligo design, see below.
Sequences Required for Directional Cloning
To enable directional cloning of the ds oligo into pENTR™/H1/TO, you must add the following 4 nucleotides to the 5' end of the corresponding ss oligo:
- Top strand oligo: Add CACC to the 5' end of the oligo. The CACC is complementary to the overhang sequence, GTGG, in the pENTR™/H1/TO vector and constitutes the last 4 bases of the H1/TO promoter.
- Bottom strand oligo: Add AAAA to the 5' end of the oligo. The AAAA is complementary to the overhang sequence, TTTT, in the pENTR™/H1/TO vector and constitutes the first 4 bases of the Pol III terminator.
Structural Features of the shRNA
Reminder: When designing the top strand oligo encoding the shRNA, remember that an shRNA generally contains the following structural features:
- A short nucleotide sequence derived from the target gene (i.e. target sequence), followed by
- A short loop and
- A short nucleotide sequence that is the reverse complement of the initial target sequence.
Note that upon transcription, the target sequence and its complement base pair to form the stem of the shRNA. For guidelines to choose the target and loop sequences, see below.
Choosing the Target Sequence
When performing RNAi analysis on a particular gene, your choice of target sequence can significantly affect the degree of gene knockdown observed. We recommend following the guidelines below when choosing your target sequence. Note that these are general recommendations only, and that exceptions may occur.
Length: We recommend choosing a target sequence ranging from 19 to 29 nucleotides in length. Longer sequences may induce non-specific responses in mammalian cells.
Complexity:
- Make sure that the target sequence does not contain runs of more than three of the same nucleotide. In particular, avoid choosing a target sequence that contains runs of four thymidines (T’s) as this will result in early transcription termination.
- Choose a sequence with low GC content (~30-50% GC content is recommended).
- Avoid choosing a target sequence that is a known site for RNA-protein interaction.
Homology: Make sure that the target sequence does not contain significant homology to other genes as this can increase off-target RNAi effects.
Orientation: You may choose a target sequence encoding the sense sequence of the target mRNA or the antisense sequence. Thus, you can generate an shRNA in two possible orientations: sense sequence-loop-antisense sequence or antisense sequence-loop-sense sequence.
siRNA: If you have identified a synthetic siRNA that is active in triggering knockdown of your target gene, try generating an shRNA using this same target sequence.
Loop Sequence
You may use a loop sequence of any length ranging from 4 to 11 nucleotides, although short loops (i.e. 4-7 nucleotides) are generally preferred. Avoid using a loop sequence containing thymidines (T’s) as they may cause early termination. This is particularly true if the target sequence (see the previous page) itself ends in one or more T nucleotides.
Note: We have included the following loop sequences in active shRNA molecules:
- 5' -CGAA-3'
- 5' -AACG-3'
- 5' -GAGA-3'
Transcription of the shRNA initiates at the first base following the end of the H1/TO promoter sequence. In the top strand oligo, the transcription initiation site corresponds to the first nucleotide following the four base pair CACC sequence added to permit directional cloning. We recommend initiating the shRNA sequence at an adenosine (A) or a guanosine (G). Note that transcription of the native H1 RNA initiates at an A. Initiating transcription at a C or T is generally not recommended as this may affect initiation efficiency and position. When choosing the transcription initiation site, you should also keep the following in mind:
Initiation at an A
- If A is the first base of the target sequence, you do not need to add the complementary T to the 3' end of the top strand oligo because the T will be supplied by the first base of the Pol III terminator. Similarly, if the first 2 or 3 bases of the target sequence are A’s, you may omit adding the complementary T’s to the 3' end of the top strand oligo. For an example, see Example 2 below.
- If A is not the first base of the target sequence, add an A to the 5' end of the top strand oligo. You may omit adding a complementary T to the 3' end of the top strand oligo as the T will be supplied by the first base of the Pol III terminator.
Initiation at a G
- If G is the first base of the target sequence, then add a complementary C to the 3' end of the top strand oligo.
- If G is not the first base of the target sequence, we recommend adding a G to the 5' end of the top strand oligo directly following the CACC overhang sequence. In this case, do not add the complementary C to the 3' end of the top strand oligo. For an example, see Example 1 below. Note: We have found that adding the complementary C in this situation can result in reduced activity of the shRNA.
If you plan to express the same shRNA from both the pENTR™/H1/TO vector and Invitrogen’s pENTR™/U6 vector (i.e. BLOCK-iT™ U6 RNAi Entry Vector Kit, Catalog no. K4945-00), we recommend initiating the shRNA sequence at a G as this is the preferred initiation site for the U6 promoter. Generating shRNA sequence that initiates at a G allows the shRNA to be compatible for cloning and expression from either pENTR™/H1/TO or pENTR™U6.
Do not add 5' phosphates to your ss oligos during synthesis. The phosphate groups necessary for ligation are present in the linearized pENTR™/H1/TO vector.
Example 1: ss Oligo Design
This example lists the sequences of top and bottom strand oligos encoding an shRNA targeting the lamin A/C gene. These particular ss oligos were annealed to generate a lamin ds oligo that was cloned into pENTR™/H1/TO. The resulting lamin H1/TO RNAi cassette was transferred into the pLenti4/BLOCK-iT™-DEST vector in an LR recombination reaction to generate the pLenti4-GW/H1/TO-laminshRNA construct supplied in the BLOCK-iT™ Inducible H1 Lentiviral RNAi System (Catalog no. K4925-00).
Example 2: ss Oligo Design
This example lists the sequences of top and bottom strand oligos encoding an shRNA targeting the lacZ gene. These particular ss oligos were annealed to generate the lacZ2.1 ds control oligo supplied in the kit. Note that in this shRNA sequence, the first 3 bases of the target sequence are A’s. Thus, the 3 corresponding T’s were omitted from the 3' end of the top strand oligo.
We generally order unpurified, desalted single-stranded oligos using Invitrogen’s custom primer synthesis service (see www.invitrogen.com for more information) The ss oligos obtained anneal efficiently and provide optimal cloning results. Note however, that depending on which supplier you use, the purity and quality of the ss oligos may vary. If you obtain variable annealing and cloning results using unpurified, desalted oligos, you may want to order oligos that are HPLC or PAGE-purified.
Cloning Site and Recombination Region of pENTR™/H1/TO
Use the diagram below to help you design suitable DNA oligonucleotides to clone into pENTR™/H1/TO after annealing. Note the following features in the diagram below:
- The pENTR™/H1/TO vector is supplied linearized between nucleotides 1935 and 1936. The linearized vector contains 4 nucleotide overhangs on each strand encoding the last 4 nucleotides of the H1/TO promoter and the first 4 nucleotides of the Pol III terminator. Note that the annealed double-stranded (ds) oligo must contain specific 4 nucleotide 5' overhangs on each strand as indicated.
- The shaded region corresponds to those DNA sequences that will be transferred from the entry clone into the Gateway® destination vector (e.g. pLenti4/BLOCK-iT™-DEST) following recombination.
Note: Following recombination with a Gateway® destination vector, the resulting expression clone will contain an RNAi cassette consisting of the H1/TO promoter, shRNA sequence, and the Pol III terminator.
The sequence of pENTR™/H1/TO is available for downloading from our Web site (www.invitrogen.com) or by contacting Technical Service. For a map of pENTR™/H1/TO, see the Appendix.
Generating the Double-Stranded Oligo (ds oligo)
Introduction
Once you have synthesized the appropriate complementary single-stranded DNA oligos, you will anneal equal amounts of each single-stranded oligo to generate a double-stranded oligo (ds oligo). Guidelines and instructions are provided in this section.
Single-Stranded Oligos
Before beginning, make sure that you have synthesized the single-stranded oligos with the appropriate sequences required for cloning into the pENTR™/H1/TO vector and for annealing. See the figure below for an illustration.
- “Top strand” oligo: Make sure that this oligo contains the sequence, CACC, at the 5' end.
- “Bottom strand” oligo: Make sure that this oligo contains the sequence, AAAA, at the 5' end and is complementary to the top strand oligo.

Amount of DNA Oligo to Anneal
You will anneal equal amounts of the top and bottom strand oligos to generate the ds oligos. We generally perform the annealing reaction at a final single-stranded oligo concentration of 50 µM. Annealing at concentrations lower than 50 µM can significantly reduce the efficiency. Note that the annealing step is not 100% efficient; at least half of the single-stranded oligos remain unannealed even at a concentration of 50 µM.
Resuspending the Oligos
If your single-stranded oligos are supplied lyophilized, resuspend them in water or TE Buffer to a final concentration of 200 µM before use.
Materials Needed
Have the following materials on hand before beginning:
- Your “top strand” single-stranded oligo (200 µM in water or TE Buffer)
- Your “bottom strand” single-stranded oligo (200 µM in water or TE Buffer)
- 10X Oligo Annealing Buffer (supplied with the kit, Box 1)
- DNase/RNase-Free Water (supplied with the kit, Box 1)
- 0.5 ml sterile microcentrifuge tubes
- 95° C water bath or heat block
Follow this procedure to anneal your single-stranded oligos to generate the ds oligo. Note that the final concentration of the oligo mixture is 50 µM.
- In a 0.5 ml sterile microcentrifuge tube, set up the following annealing reaction at room temperature.
- Incubate the reaction at 95° C for 4 minutes.
- Remove the tube containing the annealing reaction from the water bath or the heat block and set on your laboratory bench.
- Allow the reaction mixture to cool to room temperature for 5-10 minutes. The single-stranded oligos will anneal during this time.
- Place the sample in a microcentrifuge and centrifuge briefly (~5 seconds). Mix gently.
- Remove 1 µl of the annealing mixture and dilute the ds oligo as directed in Diluting the ds Oligo.
- Store the remainder of the 50 µM ds oligo mixture at -20° C.
Reagent | Amount |
“Top strand” DNA oligo (200 µM) | 5 µl |
“Bottom strand” DNA oligo (200 µM) | 5 µl |
10X Oligo Annealing Buffer | 2 µl |
DNase/RNase-Free Water | 8 µl |
Total volume | 20 µl |
Diluting the ds Oligo
To clone your ds oligo into pENTR™/H1/TO, you must dilute the 50 µM stock to a final concentration of 5 nM (i.e. 10,000-fold dilution). We generally perform two 100-fold serial dilutions, the first into DNase/RNase-free water and the second into the 1X Oligo Annealing Buffer supplied with the kit. Follow the procedure below to dilute the ds oligo.
- Dilute the 50 µM ds oligo mixture (from Annealing Procedure, Step 5) 100-fold into DNase/RNase-free water (i.e. 1 µl of 50 µM ds oligo into 99 µl of DNase/RNase-free water) to obtain a final concentration of 500 nM. Vortex to mix thoroughly.
- Dilute the 500 nM ds oligo mixture (from Step 1) 100-fold into 1X Oligo Annealing Buffer as follows to obtain a final concentration of 5 nM. Vortex to mix thoroughly. Store the remaining 500 nM ds oligo stock at -20° C.
- Aliquot the 5 nM ds oligo stock and store at -20° C.
500 nM ds oligo 1 µl
10X Oligo Annealing Buffer 10 µl
DNase/RNase-free water 89 µl
Total volume 100 µl
The undiluted ds oligos are 10,000-fold more concentrated than the working concentration. When performing the dilutions, be careful not to cross-contaminate the different ds oligo stocks. Remember to wear gloves and change pipette tips after every manipulation.
Storing the ds Oligo
Once you have diluted your ds oligo, you should have three stocks of annealed ds oligo. Use each stock as follows:
- 50 µM ds oligo (undiluted): Use this stock to prepare new diluted ds oligo stocks if existing stocks become denatured or cross-contaminated.
- 500 nM ds oligo (100-fold dilution): Use this stock for gel analysis (see Checking the Integrity of the ds Oligo).
- 5 nM ds oligo (10,000-fold dilution): Use this stock for cloning.
Store the three ds oligo stocks at -20° C .
When using the diluted ds oligo stock solutions (i.e. 100-fold or 10,000-fold diluted stocks), thaw the solutions on ice. Do not heat or allow the ds oligo solutions to reach greater than room temperature as this causes the ds oligos to melt. The concentration of the oligos in the diluted solutions is not high enough to permit re-annealing and instead favors the formation of intramolecular hairpin structures. These intramolecular hairpin structures will not clone into pENTR™/H1/TO.
If your diluted ds oligo stock solution(s) is heated, discard the ds oligo solution and prepare new diluted stocks using the procedure above.
Note: If the 50 µM ds oligo solution (undiluted stock) becomes heated, the oligos are sufficiently concentrated and may be re-annealed following the annealing procedure.
Checking the Integrity of the ds Oligo
You may verify the integrity of your annealed ds oligo using agarose gel electrophoresis, if desired. We suggest running an aliquot of the annealed ds oligo (5 µl of the 500 nM stock) and comparing it to an aliquot of each starting single-stranded oligo (dilute the 200 µM stock 4000-fold to 500 nM; use 5 µl for gel analysis). Be sure to include an appropriate molecular weight standard. We generally use the following gel and molecular weight standard:
- Agarose gel: 4% E-Gel® (Invitrogen, Catalog no. G5000-04)
- Molecular weight standard: 10 bp DNA Ladder (Invitrogen, Catalog no. 10821-015)
What You Should See
When analyzing an aliquot of the annealed ds oligo reaction by agarose gel electrophoresis, we generally see the following:
•A detectable higher molecular weight band representing annealed ds oligo.
•A detectable lower molecular weight band representing unannealed single-stranded oligos. Note that this band is detected since a significant amount of the single-stranded oligo remains unannealed.
For an example of expected results obtained from agarose gel analysis, see below. If the band representing ds oligo is weak or if you do not see a band, see Troubleshooting, for tips to troubleshoot your annealing reaction.
The efficiency at which ss oligos anneal may vary depending on their sequence and length. When analyzing the annealed ds oligo reaction by agarose gel electrophoresis, evaluate the annealing efficiency and roughly estimate the percentage of annealed ds oligo produced by comparing the intensity of the higher molecular weight band (annealed ds oligo) to the lower molecular band (unannealed ss oligos). You will use this information when setting up your ligation reaction.
Example of Expected Results
In this experiment, two 47 bp oligos (top and bottom strand) were annealed (50 µM final concentration) using the reagents supplied in the kit and following the procedure to generate a ds control oligo. The annealing reaction was diluted 100-fold in water to a concentration of 500 nM. Aliquots of the diluted ds oligo (5 µl) and each corresponding single-stranded oligo (5 µl of a 500 nM stock) were analyzed on a 4% E-Gel®.
Results: The ds oligo annealing reaction shows a clearly detectable, higher molecular weight band that differs in size from each component single-stranded oligo. Remaining unannealed ss oligo is also detectable. In this reaction, we estimate that the efficiency of the annealing reaction was greater than 50%.
Note: The agarose gel is non-denaturing; therefore, the single-stranded oligos do not resolve at the expected size due to formation of secondary structure.
Performing the Ligation Reaction
Once you have generated your ds oligo and have diluted it to the appropriate concentration, you will clone the ds oligo into the pENTR™/H1/TO vector and transform your ligation reaction into competent TOP10 E. coli. It is important to have everything you need set up and ready to use to ensure that you obtain the best results. We suggest that you read the sections entitled Performing the Ligation Reaction and Transforming One Shot® TOP10 Competent E. coli before beginning.
You will use T4 DNA Ligase and a 5X Ligation Buffer supplied with the kit to facilitate ligation of your ds oligo with the linearized pENTR™/H1/TO vector. When performing the ligation reaction, note the following:
- The T4 DNA Ligase and the 5X Ligation Buffer supplied with the kit have been optimized to permit ligation of the ds oligo into the pENTR™/H1/TO vector in 5 minutes at room temperature. T4 DNA Ligase preparations and reaction buffers available from other manufacturers may not be appropriate for use in this application.
- Note: The T4 DNA Ligase and reaction buffer supplied in the BLOCK-iT™ Inducible H1 RNAi Kits is available separately from Invitrogen (Catalog no. 15224-017).
- •Traditional ligation reactions are performed at 16° C overnight. This is not recommended for this application. Follow the ligation procedure below.
Amount of ds Oligo to Use
For optimal results, use a 10:1 to 50:1 molar ratio of ds oligo insert:vector in the ligation reaction. This ratio is achieved when 1-5 µl of the 5 nM ds oligo stock solution is used for ligation. Note the following:
- If your ss oligos have annealed efficiently (i.e. the intensity of the higher molecular weight band is greater than the intensity of the lower molecular weight band on an agarose gel), then use 1-2 µl of the 5 nM ds oligo stock in the ligation reaction.
- If your ss oligos anneal less efficiently (i.e. the intensity of the higher molecular is equivalent to or less than the intensity of the lower molecular weight band on an agarose gel), then increase the amount of the 5 nM ds oligo stock used in the ligation reaction from 1 µl up to 5 µl.
Positive Control
We recommend including the lacZ2.1 ds control oligo supplied with the kit as a positive control in your ligation experiment. The lacZ2.1 ds control oligo is supplied ready-to-use as a 5 nM stock in 1X Oligo Annealing Buffer. Note that the lacZ2.1 ss control oligos anneal less efficiently than other ss oligos; therefore, we recommend using 5 µl of the 5 nM ds oligo stock in the ligation reaction.
Tip: Once you have cloned the lacZ2.1 ds control oligo into pENTR™/H1/TO, you may use the resulting entry clone as a positive control for the RNAi response in your mammalian cell line. Simply co-transfect the entry clone and the pcDNA™1.2/V5-GW/lacZ reporter plasmid supplied with the kit into your mammalian cell line and assay for knockdown of b-galactosidase expression.
Reminder: When using the 5 nM ds oligo stock solution for cloning, thaw the solution on ice. Do not thaw the ds oligo by heating or the ds oligo duplexes may melt and form intramolecular hairpin structures. After use, return the tube to -20° C storage.
Materials Needed
Have the following reagents on hand before beginning:
- Double-stranded oligo of interest (5 nM in 1X Oligo Annealing Buffer; thaw on ice before use)
- pENTR™/H1/TO, linearized (0.5 ng/µl, supplied with the kit, Box 1; thaw on ice before use)
- lacZ2.1 ds control oligo (if desired; 5 nM in 1X Oligo Annealing Buffer; thaw on ice before use)
- 5X Ligation Buffer (supplied with the kit, Box 1)
- DNase/RNase-Free Water (supplied with the kit, Box 1)
- T4 DNA Ligase (1 U/µl, supplied with the kit, Box 1)
Ligation Procedure
Follow the procedure below to perform the ligation reaction. If you wish to include a negative control, set up a separate ligation reaction but omit the ds oligo.
1. Set up a 20 µl ligation reaction at room temperature using the following reagents in the order shown.
| Reagent | Sample | Positive Control |
| 5X Ligation Buffer | 4 µl | 4 µl |
| pENTR™/H1/TO (0.5 ng/µl) | 2 µl | 2 µl |
| ds oligo (5 nM; i.e. 1:10,000 dilution) | 1-5 µl | -- |
| lacZ2.1 ds control oligo ( 5 nM) | -- | 5 µl |
| DNase/RNase-Free Water | to a final volume of 19 µl | 8 µl |
| T4 DNA Ligase (1 U/µl) | 1 µl | 1 µl |
| Total volume | 20 µl | 20 µl |
2. Mix reaction well by pipetting up and down.
- Note: The presence of PEG and glycerol (supplied by the Ligation Buffer and the T4 DNA Ligase) will make the reaction mixture viscous. Be sure to mix the reaction thoroughly by pipetting up and down. Do not vortex.
3. Incubate for 5 minutes at room temperature.
- Note: The incubation time may be extended up to 2 hours and may result in a higher yield of colonies.
4. Place the reaction on ice and proceed to Transforming One Shot® TOP10 Competent E. coli.
- Note: You may store the ligation reaction at -20° C overnight.
Transforming One Shot® TOP10 Competent E. coli
Once you have performed the ligation reaction, you will transform your ligation mixture into competent E. coli. One Shot® TOP10 Chemically Competent E. coli (Box 2) are included with the kit to facilitate transformation. One Shot® TOP10 E. coli have a transformation efficiency of >1 x 109 cfu/µg plasmid DNA.
Materials to Have on Hand
You will need to have the following materials on hand before beginning:
- Ligation reaction (from Step 3)
- One Shot® TOP10 Chemically Competent E. coli (supplied with the kit, Box 2; one vial per transformation; thaw on ice immediately before use)
- S.O.C. Medium (supplied with the kit, Box 2; warm to room temperature)
- pUC19 positive control (supplied with the kit, Box 2; if desired)
- 42° C water bath
- LB plates containing 50 µg/ml kanamycin (two for each transformation; warm at 37° C for 30 minutes before use) Alternative: You may use Low Salt LB plates containing 50 µg/ml Zeocin™ to select for transformants, if desired. Note that for Zeocin™ to be active, the salt concentration of the bacterial medium must be < 90 mM and the pH must be 7.5.
- LB plates containing 100 µg/ml ampicillin (if transforming the pUC19 control)
- 37° C shaking and non-shaking incubator
One Shot® TOP10 Transformation Procedure
Use this procedure to transform your ligation reaction into One Shot® TOP10 Chemically Competent E. coli. To include a positive control for transformation, transform 10 pg (1 µl) of pUC19 plasmid into a separate vial of One Shot® TOP10 competent E. coli.
- Add 2 µl of the ligation reaction (from Step 3), into a vial of One Shot® TOP10 chemically competent E. coli and mix gently. Do not mix by pipetting up and down.
- Incubate on ice for 5 to 30 minutes.
- Heat-shock the cells for 30 seconds at 42° C without shaking.
- Immediately transfer the tubes to ice.
- Add 250 µl of room temperature S.O.C. Medium.
- Cap the tube tightly and shake the tube horizontally (200 rpm) at 37° C for 1 hour.
- Spread 40-200 µl from each transformation on a pre-warmed selective plate and incubate overnight at 37° C. We recommend plating two different volumes to ensure that at least one plate will have well-spaced colonies. If you are transforming the pUC19 control, plate 20-100 µl of the transformation reaction on pre-warmed LB plates containing 100 µg/ml ampicillin.
- An efficient ligation reaction may produce several hundred colonies. Pick 5-10 colonies for analysis (see Analyzing Transformants).
Note: Longer incubations seem to have a minimal effect on transformation efficiency. The length of the incubation is at the user’s discretion.
Analyzing Transformants
- Pick 5-10 kanamycin-resistant colonies and culture them overnight in LB or SOB medium containing 50 µg/ml kanamycin or Low Salt LB medium containing 50 µg/ml Zeocin™.
- Isolate plasmid DNA using your method of choice. To obtain pure plasmid DNA for automated or manual sequencing, we recommend using the PureLink™ HQ Mini Plasmid Purification Kit (Catalog no. K2100-01) or the S.N.A.P.™ MidiPrep Kit (Catalog no. K1910-01) available from Invitrogen.
- Sequence each pENTR™/H1/TO entry construct (see below) to confirm the following:
- The presence and correct orientation of the ds oligo insert.
- The sequence of the ds oligo insert.
- Note: Because of the small size of the ds oligo insert, we do not recommend using restriction enzyme analysis to screen transformants.
We highly recommend sequencing positive transformants to confirm the sequence of the ds oligo insert. When screening transformants, we find that up to 20% of the clones may contain mutated inserts (generally 1 or 2 bp deletions within the ds oligo). The reason for this is not known, but may be due to triggering of repair mechanisms within E. coli as a result of the inverted repeat sequence within the ds oligo insert.
- Note: Entry clones containing mutated ds oligo inserts generally elicit a poor RNAi response in mammalian cells. Identify entry clones with the correct ds oligo sequence and use these clones for your RNAi analysis.
Sequencing
To facilitate sequencing of your pENTR™/H1/TO entry clones, use the H1 Forward and M13 Reverse Primers supplied with the kit (Box 1). See the vector map diagram on P.19 for the location of the priming sites.
If you download the sequence for pENTR™/H1/TO from our Web site, note that the overhang sequences will be shown already hybridized to their complementary sequences (e.g. GTGG will be shown hybridized to CACC and TTTT will be shown hybridized to AAAA).
In some cases, you may have difficulty sequencing the ds oligo insert in your pENTR™/H1/TO construct. This is because the hairpin sequence is an inverted repeat that can form secondary structure during sequencing, resulting in a drop in the sequencing signal when entering the hairpin. If you have difficulty sequencing your entry constructs, we suggest trying the following to improve your sequencing results:
- Use high-quality, purified plasmid DNA for sequencing. We recommend preparing DNA using Invitrogen’s PureLink HQ Mini Plasmid Purification Kit (Catalog no. K2100-01) or S.N.A.P.™ MidiPrep Kit (Catalog no. K1910-01).
- Add DMSO to the sequencing reaction to a final concentration of 5%.
- Increase the amount of template used in the reaction (up to twice the normal concentration).
- Standard sequencing kits typically use dITP in place of dGTP to reduce G:C compression. Other kits containing dGTP are available for sequencing G-rich and GT-rich templates. If you are using a standard commercial sequencing kit containing dITP, obtain a sequencing kit containing dGTP (e.g. dGTP BigDye® Terminator v3.0 Cycle Sequencing Ready Reaction Kit, Applied Biosystems, Catalog no. 4390229) and use a 7:1 molar ratio of dITP:dGTP in your sequencing reaction.
Long-Term Storage
Once you have identified the correct entry clone, be sure to purify the colony and make a glycerol stock for long-term storage. We recommend that you store a stock of plasmid DNA at -20° C.
- Streak the original colony out for a single colony on an LB plate containing 50 µg/ml kanamycin or a Low Salt LB plate containing 50 µg/ml Zeocin™.
- Isolate a single colony and inoculate into 1-2 ml of LB containing 50 µg/ml kanamycin or Low Salt LB containing 50 µg/ml Zeocin™.
- Grow until the culture reaches stationary phase.
- Mix 0.85 ml of culture with 0.15 ml of sterile glycerol and transfer to a cryovial.
- Store the glycerol stock at -80° C.
What to Do Next
Once you have obtained your pENTR™/H1/TO entry clone, you have a number of options to express your shRNA of interest to perform RNAi analysis. See General Considerations for Transfection and Regulated Expression, next section for a discussion of your expression options.
General Considerations for Transfection and Regulated Expression
Introduction
Once you have generated your pENTR™/H1/TO entry construct, you are ready to express your shRNA of interest and to perform RNAi analysis of your target gene. This section provides general guidelines to help you design your transfection and RNAi experiment. We recommend that you read through this section before beginning.
Factors Affecting Gene Knockdown Levels
A number of factors can influence the degree to which expression of your gene of interest is reduced (i.e. gene knockdown) in an RNAi experiment including:
- Transfection efficiency
- Transcription rate of the target gene of interest
- Stability of the target protein
- Growth characteristics of your mammalian cell line
- Efficacy of the shRNA of interest
Take these factors into account when designing your RNAi experiments.
shRNA Expression Options
A number of options exist to express your shRNA of interest in the mammalian cell line of choice for RNAi analysis. Choose the option that best fits your needs.
Option | Procedure | Benefit |
1 | Co-transfect the pENTR™/H1/TO construct and a TetR-expressing plasmid (e.g. pcDNA™6/TR or pLenti6/TR) into mammalian cells | Perform regulated shRNA expression experiments with a single construct for quick screening purposes. Note: Significant basal expression of the shRNA may be observed with this option. |
2 | Obtain or generate a mammalian cell line that stably expresses the Tet repressor. Use this cell line as the host for the pENTR™/H1/TO construct. Select for a double stable cell line, if desired. | Perform transient or stable, regulated shRNA expression experiments with multiple shRNA constructs using a cell line that consistently expresses the same amount of Tet repressor. |
3 | Transfer the H1/TO RNAi cassette from pENTR™/H1/TO into a suitable Gateway® destination vector (e.g. pLenti4/BLOCK-iT™-DEST) by LR recombination to generate an expression clone. | Perform other RNAi applications (e.g. regulated shRNA expression in non-dividing mammalian cells using the pLenti4/BLOCK-iT™-DEST construct). |
4 | Transfect the pENTR™/H1/TO construct into any non-TetR-expressing, dividing mammalian cell line. Select for a stable cell line, if desired. | Constitutively express the shRNA of interest. |
Expression of Tet Repressor (TetR)
Because tetracycline-regulated shRNA expression in the BLOCK-iT™ Inducible H1 RNAi System is based on a repression/derepression mechanism, the amount of Tet repressor that is expressed in the host cell line will determine the level of transcriptional repression of the Tet operator sequences in your pENTR™/H1/TO construct. Tet repressor levels need to be sufficiently high to suitably repress basal level transcription of the shRNA, thus suppressing target gene knockdown in uninduced cells. In addition, the most effective repression of basal shRNA expression is achieved when Tet repressor is present in mammalian cells prior to introduction of the pENTR™/H1/TO construct.
For these reasons, we recommend first generating a stable cell line expressing the Tet repressor, then using this cell line as the host for your pENTR™/H1/TO entry construct (Option 2), or other suitable inducible expression construct (Option 3 above.) This option is particularly recommended if you want to:
- Perform regulated RNAi knockdown experiments with several shRNA expression constructs in the same mammalian cell line.
- Obtain the lowest levels of basal shRNA expression (i.e. lowest levels of target gene knockdown in the absence of tetracycline)
To obtain a TetR-expressing stable cell line from Invitrogen, see the Recommendation below. For guidelines to generate your own stable TetR-expressing cell line, see Generating a TetR-Expressing Host Cell Line.
Several T-REx™ cell lines that stably express the Tet repressor are available from Invitrogen . If you wish to assay for tetracycline-regulated expression of your gene of interest in 293, HeLa, CHO, or Jurkat cells, you may want to use one of the T-REx™ cell lines as the host for your pENTR™/H1/TO entry construct.
Note: The T-REx™ cell lines stably express the Tet repressor from the pcDNA™6/TR expression plasmid. This plasmid is used to generate stable TetR-expressing cell lines in Invitrogen’s T-REx™ System. Both pLenti6/TR and pcDNA™6/TR contain the same TetR gene. For more information about the T-REx™ cell lines or pcDNA™6/TR, see our Web site (www.invitrogen.com) or contact Technical Service.
Methods of Transfection
For established cell lines (e.g. COS, A549), consult original references or the supplier of your cell line for the optimal method of transfection. Pay particular attention to media requirements, when to pass the cells, and at what dilution to split the cells. Further information is provided in Current Protocols in Molecular Biology (Ausubel et al., 1994).
Methods for transfection include calcium phosphate (Chen and Okayama, 1987; Wigler et al., 1977), lipid-mediated (Felgner et al., 1989; Felgner and Ringold, 1989), and electroporation (Chu et al., 1987; Shigekawa and Dower, 1988). Choose the method and reagent that provides the highest efficiency transfection in your mammalian cell line. For a recommendation, see below.
For high-efficiency transfection in a broad range of mammalian cell lines, we recommend using the cationic lipid-based Lipofectamine™ 2000 Reagent (Catalog no. 11668-027) available from Invitrogen (Ciccarone et al., 1999). Using Lipofectamine™ 2000 to transfect plasmid DNA into eukaryotic cells offers the following advantages:
- Provides the highest transfection efficiency in many mammalian cell types.
- DNA-Lipofectamine™ 2000 complexes can be added directly to cells in culture medium in the presence of serum.
- Removal of complexes, medium change, or medium addition following transfection is not required, although complexes can be removed after 4-6 hours without loss of activity.
For more information on Lipofectamine™ 2000 Reagent, refer to our Web site (www.invitrogen.com) or call Technical Service
Transient vs. Stable Expression of Your shRNA
When designing your RNAi experiment, you should consider how to assay for knockdown of the target gene. After you have transfected your pENTR™/H1/TO construct into TetR-expressing mammalian cells, you may:
- Pool a heterogeneous population of cells and test for target gene knockdown after induction with tetracycline (i.e. transient knockdown). We recommend waiting for a minimum of 24-48 hours after induction before assaying for target gene knockdown to allow time for the shRNA to be expressed and processed.
- Select for stably transfected cells using Zeocin™. Selection requires a minimum of 10-14 days after transfection, but allows generation of clonal cell lines that stably express the shRNA of interest. shRNA expression will be tetracycline-regulated. For more information about Zeocin™ selection, see Generating a Stable Cell Line.
Tetracycline
(MW = 444.4) is commonly used as a broad spectrum antibiotic and acts to inhibit translation by blocking polypeptide chain elongation in bacteria. In the BLOCK-iT™ Inducible H1 RNAi System, tetracycline functions as an inducing agent to regulate transcription of the shRNA of interest from the H1/TO RNAi cassette. Tetracycline is supplied with the BLOCK-iT™ Inducible H1 RNAi Kits as a 10 mg/ml stock solution that is ready-to-use, but is also available separately from Invitrogen in powdered form (Catalog no. Q100-19).
Using Tetracycline
To induce transcription of the shRNA of interest in mammalian cells, we generally add tetracycline to a final concentration of 1 µg/ml in complete growth medium. If desired, you may vary the concentration of tetracycline used for induction from 0.001 to 1 µg/ml to modulate expression of the shRNA of interest.
Note: The concentrations of tetracycline used for induction in the BLOCK-iT™ Inducible H1 RNAi System are generally not high enough to be toxic to mammalian cells.
Follow the guidelines below when handling tetracycline.
- Tetracycline is light sensitive. Store the stock solution at -20° C, protected from light. Prepare medium containing tetracycline immediately before use.
- Tetracycline is toxic. Do not ingest solutions containing the drug. If handling the powdered form, do not inhale.
- Wear gloves, a laboratory coat, and safety glasses or goggles when handling tetracycline and tetracycline-containing solutions.
Tetracycline in Fetal Bovine Serum
When culturing cells in medium containing fetal bovine serum (FBS), note that many lots of FBS contain tetracycline as FBS is often isolated from cows that have been fed a diet containing tetracycline. If you culture your mammalian cells in medium containing FBS that is not reduced in tetracycline, you may observe some basal expression of your shRNA of interest in the absence of tetracycline. We generally culture our mammalian cells in medium containing FBS that may not be reduced in tetracycline, and have observed low basal expression of shRNA (as assayed by % target gene knockdown) in the absence of tetracycline. Depending on your application (e.g. if targeting a protein involved in cell viability), you may wish to culture your cells in tetracycline-tested FBS. You may obtain tetracycline-tested GIBCO® FBS from Invitrogen.
Transfecting Cells
Introduction
This section provides general guidelines to transfect your pENTR™/H1/TO construct into a TetR-expressing mammalian cell line of interest to perform transient, regulated RNAi analysis. Performing transient RNAi analysis is useful to:
- Quickly test multiple shRNA sequences to a particular target gene
- Quickly screen for an RNAi response in your mammalian cell line
If you want to generate a stable cell line expressing the shRNA of interest, see the next section.
Reminder: For optimal results, we recommend that you transfect your pENTR™/H1/TO construct into a mammalian cell line that stably expresses high levels of the Tet repressor (i.e. use one of Invitrogen’s T-REx™ Cell Lines or a cell line that you have generated). If you have not generated a stable TetR-expressing cell line, you may co-transfect the pENTR™/H1/TO plasmid with a suitable TetR-expressing plasmid (i.e. pcDNA™6/TR or pLenti6/TR) into your mammalian cell line. If you wish to use this method, we recommend using 6-fold more TetR expression plasmid DNA than pENTR™/H1/TO plasmid DNA in the co-transfection. For example, use 600 ng of pcDNA™6/TR plasmid and 100 ng of pENTR™/H1/TO entry construct DNA when transfecting cells plated in a 24-well format. Note that you may need to optimize repression and inducibility by varying the ratio of TetR expression plasmid:pENTR™/H1/TO used for transfection.
Plasmid Preparation
Once you have obtained your entry clone, you must isolate plasmid DNA for transfection. Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol or sodium chloride. Contaminants will kill the cells, and salt will interfere with lipid complexing, decreasing transfection efficiency. We recommend isolating plasmid DNA using the PureLink™ HQ Mini Plasmid Purification Kit (Catalog no. K2100-01), S.N.A.P.™ MidiPrep Kit (Catalog no. K1910-01) or CsCl gradient centrifugation.
Positive Control
If you have performed the positive control reaction and have cloned the lacZ2.1 ds oligo supplied with the kit into pENTR™/H1/TO, we recommend using the resulting pENTR™-GW/H1/TO-lacZ2.1shRNA entry construct as a positive control to assess the RNAi response in your cell line. Simply co-transfect the pENTR™-GW/H1/TO-lacZ2.1shRNA entry construct and the pcDNA™1.2/V5-GW/lacZ reporter plasmid supplied with the kit into your TetR-expressing mammalian cells and assay for knockdown of b-galactosidase expression 48 hours post-transfection using Western blot analysis or activity assay. For more information about the pcDNA™1.2/V5-GW/lacZ reporter plasmid, recommendations for transfection, and methods to assay for b-galactosidase activity, see below.
pcDNA™1.2/V5-GW/lacZ Reporter Plasmid
The pcDNA™1.2/V5-GW/lacZ reporter plasmid is supplied with the kit for use as a positive control to assay for the RNAi response in your mammalian cell line. In this vector, ß-galactosidase is expressed as a C-terminally tagged fusion protein under the control of the human cytomegalovirus (CMV) promoter.
The pcDNA™1.2/V5-GW/lacZ vector is supplied as 10 µg of plasmid DNA, lyophilized in TE Buffer, pH 8.0. To use the vector, resuspend in 10 µl of sterile water to obtain a 1 µg/µl stock. Dilute the stock as necessary for use in transfection (see below). If you wish to propagate the plasmid, transform a recA, endA E. coli strain such as TOP10. Use 10 ng of plasmid for transformation and select on LB agar plates containing 100 µg/ml ampicillin.
Transfecting the LacZ-Containing Reagents
To perform RNAi analysis using the lacZ control reagents, you will co-transfect the pcDNA™1.2/V5-GW/lacZ reporter plasmid and the pENTR™-GW/H1/TO-lacZ2.1shRNA entry construct that you have generated into your TetR-expressing mammalian cell line. For optimal results, we recommend using 6-fold more entry construct DNA than reporter plasmid DNA in the co-transfection. For example, use 600 ng of pENTR™-GW/H1/TO-lacZ2.1shRNA DNA and 100 ng of pcDNA™1.2/V5-GW/lacZ DNA when transfecting cells plated in a 24-well format.
Materials Needed
Have the following materials on hand before beginning:
- TetR-expressing mammalian cell line of interest (make sure that cells are healthy and > 90% viable before beginning) Note: If your cell line expresses TetR from pcDNA™6/TR or pLenti6/TR, maintain the cells in medium containing the appropriate concentration of Blasticidin.
- pENTR™/H1/TO entry construct
- pcDNA™1.2/V5-GW/lacZ plasmid (if performing the positive control transfection; supplied with the kit, Box 1, resuspend in water to 1 µg/µl)
- pENTR™-GW/H1/TO-lacZ2.1shRNA plasmid (if you have performed the positive control ligation reaction and are performing the positive control transfection)
- Transfection reagent of choice (e.g. Lipofectamine™ 2000)
- Tetracycline (supplied with the kit, Box 1; 10 mg/ml stock solution)
- Appropriate tissue culture dishes and supplies
Guidelines are provided below to transfect your pENTR™/H1/TO entry construct into the TetR-expressing mammalian cell line of choice and to induce expression of the shRNA of interest with tetracycline.
- One day before transfection, plate cells at a density recommended by the manufacturer of the transfection reagent you are using.
- On the day of transfection (Day 1), transfect your pENTR™/H1/TO construct into cells following the recommendations of the manufacturer of your transfection reagent. If you are co-transfecting the pENTR™/H1/TO construct and a TetR expression plasmid or the pcDNA™1.2/V5-GW/lacZ and pENTR™-GW/H1/TO-lacZ2.1shRNA plasmids, use the appropriate amounts of each plasmid as recommended.
- At an appropriate time (generally 3 to 24 hours) after transfection, remove medium and replace with fresh growth medium containing 1 µg/ml tetracycline to induce shRNA expression. Note the following:
- If you have transfected your cells using Lipofectamine™ 2000, you may add tetracycline to induce expression of your shRNA as early as 3 hours following transfection.
- If you have included the lacZ positive control plasmids in your experiment, add tetracycline to cells 3 hours after transfection. This induces expression of the lacZ2.1 shRNA and prevents accumulation of ß-galactosidase, enabling detectable measurement of lacZ knockdown that might otherwise be masked by the long half-life of ß-galactosidase.
- If you have transfected your cells using another transfection reagent, you may need to replace the medium and allow cells to recover for 24 hours before induction.
- Incubate cells in medium containing tetracycline for 24 to 96 hours, as appropriate before assaying for target gene knockdown.
Assaying for ß-galactosidase Expression
If you perform RNAi analysis using the control entry clone containing the lacZ2.1 ds oligo (i.e. pENTR™-GW/H1/TO-lacZ2.1shRNA), you may assay for ß-galacto-sidase expression and knockdown by Western blot analysis or activity assay using cell-free lysates (Miller, 1972). Invitrogen offers the ß-gal Antiserum (Catalog no. R901-25), the ß-Gal Assay Kit (Catalog no. K1455-01), and the FluoReporter® lacZ/Galactosidase Quantitation Kit (Catalog no. F-2905) for detection of ß-galactosidase expression. For an example of results obtained from a ß-galacto-sidase knockdown experiment, see below.
Note: The ß-galactosidase protein expressed from the pcDNA™1.2/V5-GW/lacZ control plasmid is fused to a V5 epitope and is approximately 119 kDa in size. If you are performing Western blot analysis, you may also use the Anti V5 Antibodies available from Invitrogen (e.g. Anti-V5-HRP Antibody; Catalog no. R961-25 or Anti-V5-AP Antibody, Catalog no. R962-25) for detection. For more information, refer to our Web site (www.invitrogen.com) or call Technical Service.
Example of Expected Results: Transient, Regulated Knockdown of a lacZ Reporter Gene
In this experiment, pENTR™/H1/TO entry constructs containing ds oligo encoding shRNA targeting the lacZ (i.e. pENTR™-GW/H1/TO-lacZ2.1shRNA) reporter gene or the endogenous lamin (i.e. pENTR™-GW/H1/TO-laminshRNA) gene were generated following the recommended protocols and using the reagents supplied in the BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit. Note that the lacZ ds oligo used in this experiment is the same as the lacZ2.1 ds control oligo supplied with the kit.
T-REx™-293 cells (Invitrogen, Catalog no. R710-07) were grown to 90% confluence. Individual wells in a 24-well plate were transfected using Lipofectamine™ 2000 Reagent with 700 ng of plasmid DNA (100 ng of the pcDNA™1.2/V5-GW/lacZ reporter plasmid and 600 ng of non-specific plasmid DNA). In some wells, the reporter plasmid was co-transfected with 600 ng of the pENTR™-GW/H1/TO-lacZ2.1shRNA or pENTR™-GW/H1/TO-laminshRNA constructs. Three hours after transfection, the medium was replaced with medium containing 1 µg/ml tetracycline. Cell lysates were prepared 48 hours after induction and assayed for ß-galactosidase activity.
Results: Potent and specific inhibition of b-galactosidase activity is evident from the lacZ-derived shRNA but not from the lamin-derived shRNA after cells have been treated with tetracycline.
Note: In this experiment, some basal expression of the lacZ-derived shRNA occurs as evidenced by the ~ 15% inhibition of ß-galactosidase activity in cells cultured in the absence of tetracycline. 
Generating a Stable Cell Line
Once you have established that your shRNA can be inducibly expressed from pENTR™/H1/TO, you may wish to establish a stable cell line that constitutively expresses the Tet repressor and inducibly expresses your shRNA. As with transient transfection, we recommend using a cell line that stably expresses the Tet repressor as a host for your pENTR™/H1/TO construct. Use a T-REx™ Cell Line available from Invitrogen or your own TetR-expressing cell line.
Zeocin™ Selection
The pENTR™/H1/TO plasmid contains the Zeocin™ resistance gene (Calmels et al., 1991; Drocourt et al., 1990) to facilitate generation of cell lines (Mulsant et al., 1988) that inducibly express the shRNA of interest. Note: If you are using the BLOCK-iT™ Inducible H1 Lentiviral RNAi System, Zeocin™ is supplied with the kit. Otherwise, Zeocin™ is available separately from Invitrogen.
Determining Zeocin™ Sensitivity for Your Cell Line
If you plan to select for stable cell lines expressing the pENTR™/H1/TO construct, you must first determine the minimum concentration of Zeocin™ that is required to kill your untransfected mammalian cell line (i.e. perform a kill curve experiment). Typically, concentrations ranging from 50-1000 µg/ml Zeocin™ are sufficient to kill most untransfected mammalian cell lines. We recommend testing a range of concentrations to ensure that you determine the minimum concentration necessary for your cell line.
1. Plate cells at approximately 25% confluence. Prepare a set of 6-7 plates. Allow cells to adhere overnight.
2. The next day, substitute culture medium with medium containing varying concentrations of Zeocin™.
3. Replenish the selective media every 3-4 days and observe the percentage of surviving cells.
4. Determine the appropriate concentration of Zeocin™ that kills the cells within 10-14 days after addition of antibiotic.
Effect of Zeocin™ on Sensitive and Resistant Cells
Zeocin™’s method of killing is quite different from that of other common antibiotics such as Blasticidin, Geneticin®, and hygromycin. Zeocin™-sensitive cells do not round up and detach from the plate, but may exhibit the following morphological changes:
- Vast increase in size (similar to the effects of cytomegalovirus infecting permissive cells)
- Abnormal cell shape
- Presence of large empty vesicles in the cytoplasm (breakdown of the endoplasmic reticulum and Golgi apparatus or scaffolding proteins)
- Breakdown of plasma and nuclear membrane (appearance of many holes in these membranes)
- Eventually, these “cells” will completely break down and only “strings” of protein will remain.
Zeocin™-resistant cells should continue to divide at regular intervals to form distinct colonies. There should not be any distinct morphological changes in Zeocin™-resistant cells when compared to non-selected cells.
Materials Needed
Have the following materials on hand before beginning:
- TetR-expressing mammalian cell line of interest (make sure that cells are healthy and > 90% viable before beginning) Note: If your cell line expresses TetR from pcDNA™6/TR or pLenti6/TR, maintain the cells in medium containing the appropriate concentration of Blasticidin.
- pENTR™/H1/TO entry construct
- Transfection reagent of choice (e.g. Lipofectamine™ 2000)
- Zeocin™ (100 mg/ml in sterile water)
- Blasticidin (to maintain the pcDNA™6/TR or pLenti6/TR construct) in the TetR-expressing cell line
- Tetracycline (supplied with the kit, Box 1; 10 mg/ml stock solution)
- Appropriate tissue culture dishes and supplies
Guidelines for Transfection and Selection
Guidelines are provided below to transfect your pENTR™/H1/TO entry construct into the TetR-expressing mammalian cell line of choice and to select for stable cell lines using Zeocin™.
- One day before transfection, plate cells at a density recommended by the manufacturer of the transfection reagent you are using.
- On the day of transfection (Day 1), transfect your pENTR™/H1/TO construct into cells following the recommendations of the manufacturer of your transfection reagent.
- Four to six hours after transfection, remove the medium and replace with fresh growth medium. Incubate the cells overnight at 37° C.
- The following day (Day 2), trypsinize and replate cells into a larger-sized tissue culture format in fresh complete medium containing the appropriate concentrations of Blasticidin and Zeocin™. Note: Blasticidin is required to maintain the pcDNA™6/TR or pLenti6/TR construct in the TetR-expressing cells. Example: If transfecting cells in a 6-well format, trypsinize and replate cells into a 10 cm tissue culture plate in medium containing Blasticidin and Zeocin™.
- Replace medium with fresh medium containing Blasticidin and Zeocin™ every 3-4 days until Blasticidin- and Zeocin™-resistant colonies can be identified (generally 10-14 days after selection).
- Pick at least 10 Blasticidin- and Zeocin™-resistant colonies and expand each clone.
- Induce expression of the shRNA of interest by adding tetracycline to a final concentration of 1 µg/ml. Wait for the appropriate length of time (e.g. 24-48 hours) before assaying for target gene knockdown. Compare to uninduced cells.
Guidelines to Perform the LR Recombination Reaction
The pENTR™/H1/TO vector contains attL sites to facilitate transfer of your H1/TO RNAi cassette (H1/TO promoter + ds oligo of interest + Pol III terminator) into an appropriate Gateway® destination vector to generate an expression clone. To transfer your H1/TO RNAi cassette into the destination vector, you will perform an LR recombination reaction using Gateway® LR Clonase™ II Enzyme Mix. Guidelines are provided in this section.
Appropriate Destination Vectors
We recommend transferring the H1/TO RNAi cassette into a promoterless Gateway® destination vector for the following RNAi applications:
- Perform delivery of the regulated shRNA of interest to “hard-to-transfect” or non-dividing mammalian cells. Use the pLenti4/BLOCK-iT™-DEST vector (see Note below).
- Generate stable cell lines expressing the regulated shRNA using a selection marker other than Zeocin™. Use the pBLOCK-iT™3-DEST vector containing the neomycin selection marker (Catalog no. V486-20).
Important: Because the H1/TO RNAi cassette contains its own promoter (i.e. H1/TO promoter), we do not recommend transferring the H1/TO RNAi cassette into destination vectors that contain a promoter (e.g. pcDNA™3.2/V5-DEST).
If you plan to perform regulated RNAi analysis in a lentiviral-based system, transfer your H1/TO RNAi cassette into Invitrogen’s pLenti4/BLOCK-iT™-DEST destination vector (Catalog nos. V488-20 or K4925-00). Do not transfer the H1/TO RNAi cassette into the pLenti6/BLOCK-iT™-DEST vector. The pLenti6/BLOCK-iT™-DEST vector contains the Blasticidin resistance marker for selection, making it incompatible for use with Blasticidin-resistant T-REx™ cell lines (both commercially available and those generated using the pcDNA™6/TR or pLenti6/TR constructs).
E. coli Host
Once you have performed the LR recombination reaction, you will transform the recombination reaction into competent E. coli and select for the appropriate transformants. You may use any recA, endA E. coli strain including TOP10, DH5a™, or equivalent for transformation. Do not transform the LR recombination reaction into E. coli strains that contain the F' episome (e.g. TOP10F'). These strains contain the ccdA gene and will prevent negative selection with the ccdB gene.
Important: When performing the LR recombination reaction with the pLenti4/BLOCK-iT™-DEST vector, use the Stbl3™ E. coli strain for transformation to obtain optimal results (see ordering information under Materials above).
We recommend performing the LR recombination reaction using a:
- Supercoiled attL-containing pENTR™/H1/TO entry clone
- Supercoiled attR-containing destination vector
Materials Needed
You will need the following reagents to perform the LR recombination reaction:
- Purified plasmid DNA of your pENTR™/H1/TO entry clone (50-150 ng/µl in TE Buffer, pH 8.0)
- Destination vector of choice (150 ng/µl in TE Buffer, pH 8.0)
- LR Clonase™ II enzyme mix (Invitrogen, Catalog no. 11791-020)
- TE Buffer, pH 8.0 (10 mM Tris-HCl, pH 8.0, 1 mM EDTA)
- 2 µg/µl Proteinase K solution (supplied with the LR Clonase™ II enzyme mix)
- Appropriate chemically competent E. coli host and growth media for expression
- S.O.C. Medium
- Appropriate selective plates
Performing the LR Recombination Reaction
For detailed guidelines and instructions to perform the LR recombination reaction with pLenti4/BLOCK-iT™-DEST and transform competent E. coli, refer to the BLOCK-iT™ Inducible H1 Lentiviral RNAi System manual. If you are using another destination vector, refer to the manual for the destination vector you are using.
Troubleshooting
Introduction
Use the information in this section to troubleshoot the annealing, cloning, transformation, and transfection procedures.
Annealing Reaction
The table below lists some potential problems and possible solutions that may help you troubleshoot the annealing reaction.
Problem | Reason | Solution |
Few kanamycin-resistant colonies obtained on the selective plate | Single-stranded oligos designed incorrectly | Make sure that each single-stranded oligo contains the 4 nucleotides on the 5°end required for cloning into pENTR™/H1/TO:
|
ds oligos stored incorrectly | Store the ds oligo stocks at -20°C. | |
Ligation reaction not incubated for long enough | Extend the incubation time of the ligation reaction up to 2 hours at room temperature. |
Ligation and Transformation Reactions
The table below lists some potential problems and possible solutions that may help you troubleshoot the ligation and transformation procedures.
Problem | Reason | Solution |
Few kanamycin-resistant colonies obtained on the selective plate, continued | ds oligos were degraded |
|
500 nM ds oligo stock solution diluted into water instead of 1X Oligo Annealing Buffer | To dilute the 50 µM ds oligo reaction: 1. Dilute the 50 µM stock 100-fold into DNase/RNase-free water to generate a 500 nM stock. 2.Dilute the 500 nM stock 100-fold into 1X Oligo Annealing Buffer to generate a 5 nM stock. Use the 5 nM stock for cloning. | |
5 nM ds oligo stock solution heated above room temperature prior to use | Thaw ds oligo stock solution on ice or at +4°C prior to use. Important: Dilute ds oligos will melt and form intramolecular hairpins if heated above room temperature. These hairpins will not clone into pENTR™/H1/TO. | |
Incorrect vector:insert ratio used in ligation reaction
|
| |
| ds oligo mixture had a lower percentage of annealed ds oligo | Increase the amount of ds oligo used in the ligation reaction (e.g. from 1 µl to 5 µl). |
Ligation reaction not adequately mixed or incorrectly mixed prior to incubation |
| |
Did not use the 5X Ligation Buffer supplied with the kit | Use the T4 DNA Ligase and 5X Ligation Buffer supplied with the kit for ligation. These reagents are optimized to facilitate 5-minute ligation at room temperature. Important: Other T4 DNA Ligase preparations may not support 5-minute, room temperature ligation. | |
Not enough transformation mixture plated | Increase the amount of the transformation mixture plated. |
Problem | Reason | Solution |
Few kanamycin-resistant colonies obtained on the selective plate, continued | Ligation reaction incubated overnight at 16° C | The ligation conditions used to clone the ds oligo into pENTR™/H1/TO differ from traditional ligation conditions. Incubate the ligation reaction at room temperature for 5 minutes. |
Selective plates contained too much kanamycin | Use LB agar plates containing 50 µg/ml kanamycin for selection. | |
Used LB agar to make selective plates containing Zeocin™ | Use Low Salt LB agar to make selective plates containing Zeocin™. | |
Did not use the competent cells supplied with the kit | Use the One Shot® TOP10 Chemically Competent E. coli supplied with the kit; trans- formation efficiency is > 1 x 109 cfu/µg DNA. | |
Not enough of the ligation reaction transformed | Increase the amount of ligation reaction transformed. | |
Did not perform the 1 hour grow-out period before plating the transformation mixture | After the heat-shock step, add S.O.C. Medium and incubate the bacterial culture for 1 hour at 37° C with shaking before plating. | |
Many clones contain inserts with sequence mutations | Poor quality single-stranded oligos used
|
|
Did not use the competent cells supplied with the kit | Use the One Shot® TOP10 Chemically Competent E. coli supplied with the kit; trans- formation efficiency is > 1 x 109 cfu/µg DNA. | |
Poor sequencing results | Loss of sequencing signal in the hairpin region due to secondary structure formation |
|
No colonies obtained on the selective plate | Used the wrong antibiotic for selection | Select for transformants on LB agar plates containing 50 µg/ml kanamycin. |
Transient Transfection and RNAi Analysis
The table below lists some potential problems and possible solutions that may help you troubleshoot your transient transfection and knockdown experiment.
Problem | Reason | Solution |
Low levels of tetracycline-regulated gene knockdown observed | Low transfection efficiency (if using Lipofectamine™ 2000 Reagent)
| Do not add antibiotics to the media during transfection.
|
Did not wait long enough after induction before assaying for gene knockdown |
| |
ds oligo insert in your pENTR™/H1/TO construct contains mutations | When analyzing kanamycin-resistant transformants, sequence the ds oligo insert to verify its sequence. Select constructs containing the correct ds oligo insert for use in RNAi analysis. | |
shRNA sequence not optimal due to:
|
| |
Did not add enough tetracycline | Increase the amount of tetracycline used for induction | |
Targeted an essential gene | Generate a stable cell line, then add tetracycline to induce shRNA expression. | |
Gene knockdown observed, but not tetracycline-regulated | Did not transfect the pENTR™/H1/TO entry construct into a cell line expressing Tet repressor | Transfect the entry construct into a cell line that expresses Tet repressor:
OR
|
Significant target gene knockdown observed in uninduced cells | Insufficient amount of Tet repressor expressed (when transfecting a stable TetRexpressing cell line) | Screen other TetR-expressing clones. Choose the clone that exhibit the highest level of TetR expression for use as the host for your pENTR™/H1/TO construct. |
Co-transfected a TetR expression plasmid and the pENTR™/H1/TO construct |
| |
When generating the TetRexpressing cell line, pcDNA™6/TR or pLenti6/TR construct introduced into a mammalian cell line in which the CMV promoter is down-regulated | Use a mammalian cell line in which the CMV promoter is not down-regulated as the host for the pcDNA™6/TR or pLenti6/TR construct. | |
No gene knockdown observed, even after tetracycline induction | shRNA with no activity chosen |
|
Hairpin designed incorrectly | Select the target sequence and design the singlestranded oligos. |
Vector Map 1- Map and Features of pENTRâ„¢/H1/TO
pENTR™/H1/TO Map
The complete nucleotide sequence of this vector is available for downloading at www.invitrogen.com or by contacting Technical Service.
Features of pENTR™/H1/TO
pENTR™/H1/TO (3869 bp) contains the following elements. All features have been functionally tested and the vector fully sequenced.
Feature | Benefit |
rrnB T1 and T2 transcription terminators | Reduces potential toxicity in E. coli by preventing basal expression of the double-stranded oligonucleotide of interest. |
SV40 polyadenylation signal | Allows transcription termination and polyadenylation of mRNA. |
Zeocin™ resistance (Sh ble) gene | Allows stable selection in mammalian cells and prokaryotes (Drocourt et al., 1990; Mulsant et al., 1988). |
EM7 promoter | Synthetic prokaryotic promoter for expression of the Zeocin™ resistance marker in E. coli. |
SV40 early promoter and origin | Allows high-level expression of the selection marker and episomal replication in cells expressing the SV40 large T antigen. |
M13 forward (-20) priming site | Allows sequencing of the insert. |
attL1 and attL2 sites | Bacteriophage l-derived recombination sequences that allow recombinational cloning of the H1/TO RNAi cassette in the entry construct with a Gateway® destination vector (Landy, 1989). |
H1 forward priming site | Allows sequencing of the insert. |
Human H1/TO promoter | Hybrid promoter consisting of the human H1 promoter (Hannon et al., 1991; Myslinksi et al., 2001) and two tetracycline operator (tetO2) sequences for RNA Polymerase III-dependent, regulated expression of the short hairpin RNA (shRNA). The tetO2 sequences serve as binding sites for Tet repressor homodimers (Hillen and Berens, 1994). |
5' overhangs | Allows ligase-mediated directional cloning of the double-stranded oligonucleotide of interest. |
Pol III terminator | Allows efficient termination of RNA Polymerase III-dependent transcription. |
M13 reverse priming site | Allows sequencing of the insert. |
Kanamycin resistance gene | Allows selection of the plasmid in E. coli. |
pUC origin of replication (ori) | Permits high-copy replication and maintenance in E. coli. |
Vector Map 2- Map of pcDNAâ„¢1.2/V5-GW/lacZ
pcDNA™1.2/V5-GW/lacZ (6498 bp) is a control vector expressing a C-terminally-tagged b-galactosidase fusion protein under the control of the human cytomegalovirus (CMV) promoter (Andersson et al., 1989; Boshart et al., 1985; Nelson et al., 1987), and was generated using the MultiSite Gateway® Three-Fragment Vector Construction Kit available from Invitrogen (Catalog no. 12537-023). Briefly, a MultiSite Gateway® LR recombination reaction was performed with pDEST™R4-R3 and entry clones containing the CMV promoter, lacZ gene, and V5 epitope and TK polyadenylation signal (Cole and Stacy, 1985) to generate the pcDNA™1.2/V5-GW/lacZ vector. b-galactosidase is expressed as a C-terminal V5 fusion protein with a molecular weight of approximately 119 kDa.
The complete sequence of pcDNA™1.2/V5-GW/lacZ is available for downloading from our Web site (http://www.invitrogen.com) or by contacting Technical Service
Recipes
1.0% Tryptone
0.5% Yeast Extract
1.0% NaCl
pH 7.0
- For 1 liter, dissolve 10 g tryptone, 5 g yeast extract, and 10 g NaCl in 950 ml deionized water.
- Adjust the pH of the solution to 7.0 with NaOH and bring the volume up to 1 liter.
- Autoclave on liquid cycle for 20 minutes. Allow solution to cool to ~55°C and add antibiotic, if desired.
- Store at +4°C.
Low Salt LB Medium or Plates Containing Zeocin™
1.0% Tryptone
0.5% Yeast Extract
0.5% NaCl
pH 7.5
- For 1 liter, dissolve 10 g tryptone, 5 g yeast extract, and 5 g NaCl in 950 ml deionized water.
- Adjust the pH of the solution to 7.5 with NaOH and bring the volume up to 1 liter. If preparing plates, add 15 g/L agar.
- Autoclave on liquid cycle for 20 minutes. Allow solution to cool to ~55°C and add Zeocin™ to a final concentration of 50 µg/ml. If preparing plates, pour into 10 cm plates.
- Store at +4°C. Plates containing Zeocin™ may be stored at +4°C for up to 2 weeks.
Tetracycline
Use this procedure to prepare a 10 mg/ml stock solution from the tetracycline salt available separately from Invitrogen (Catalog no. Q100-19). Note that the tetracycline provided with the BLOCK-iT™ Inducible H1 RNAi Kits is supplied as a 10 mg/ml solution that is ready-to-use.
Important: If you are using a different form of tetracycline (i.e. free base form), prepare the stock solution in 100% ethanol rather than water.
- Weigh out 10 mg of tetracycline and transfer to a sterile microcentrifuge tube.
- Resuspend the tetracycline in 1 ml of sterile water to produce a 10 mg/ml stock solution that is yellow in color.
- Wrap the tube in foil and store the stock solution at -20°C, protected from exposure to light.
Appendix - Generating a TetR-Expressing Host Cell Line
Guidelines are provided in this section to generate your own stable TetR-expressing host cell line. For detailed instructions, refer to the manual for the TetR expression plasmid that you are using.
Options to Generate Your Own TetR-Expressing Cell Lines
Two options exist to generate a stable TetR-expressing mammalian cell line using reagents available separately from Invitrogen. Choose the option that best fits your needs.
- Transfect the pcDNA™6/TR plasmid (i.e. TetR expression plasmid from the T-REx™ System) into your mammalian cells of interest. Use Blasticidin to select for a stable cell line.
- Transfect the pLenti6/TR plasmid (i.e. TetR expression plasmid from the ViraPower™ T-REx™ and BLOCK-iT™ Inducible H1 Lentiviral RNAi System) into your mammalian cells of interest. Alternatively, produce a Lenti6/TR lentiviral stock, and use this stock to transduce the mammalian cells of interest. Use Blasticidin to select for a stable cell line.
For more information about pcDNA™6/TR, pLenti6/TR, and Blasticidin, see the manual for each product. All manuals are available for downloading from our Web site (www.invitrogen.com) or by calling Technical Service.
Both pcDNA™6/TR and pLenti6/TR contain the same TetR gene (Postle et al., 1984). Similarly, expression of TetR from both plasmids is controlled by the human cytomegalovirus (CMV) promoter (Andersson et al., 1989; Boshart et al., 1985; Nelson et al., 1987). Although highly active in most mammalian cell lines, activity of the viral CMV promoter can be down-regulated in some cell lines due to methylation (Curradi et al., 2002), histone deacetylation (Rietveld et al., 2002), or both. When generating your own TetR-expressing cell line, be sure to use a mammalian cell line in which activity of the CMV promoter is not down-regulated.
Determining Blasticidin Sensitivity for Your Cell Line
After transfecting or transducing the pcDNA™6/TR or pLenti6/TR construct into your mammalian cells, as appropriate, you will use Blasticidin to select for a stable cell line. Before beginning, remember to determine the minimum concentration of Blasticidin that is required to kill your untransfected or untransduced mammalian cell line, as appropriate (i.e. perform a kill curve experiment).
Generating a TetR-Expressing Cell Line
For detailed instructions to generate a TetR-expressing cell line using pcDNA™6/TR or pLenti6/TR, refer to the manual for the expression plasmid you are using. If you wish to produce a lentiviral stock from pLenti6/TR and transduce mammalian cells to generate your TetR-expressing cell line, refer to the BLOCK-iT™ Inducible H1 Lentiviral RNAi System or the ViraPower™ T-REx™ manual. All manuals are available for downloading from our Web site (www.invitrogen.com) or by contacting Technical Service
After you have introduced the TetR expression construct into your mammalian cell line and have performed Blasticidin selection, screen individual clones to determine the amount of Tet repressor expressed (see below). Select for clones that express the highest levels of Tet repressor to use as hosts for your inducible pENTR™/H1/TO entry construct. Those clones that express the highest levels of Tet repressor should exhibit the most complete repression of basal transcription of your shRNA of interest.
Detecting TetR Expression
To detect Tet repressor expression, we recommend performing Western blot analysis using an Anti-Tet repressor antibody (MoBiTec, Göttingen, Germany, Catalog no. TET01).
Maintaining TetR-Expressing Cell Lines
Once you have generated your stable TetR-expressing cell line and have verified that the cells express suitable levels of Tet repressor, we recommend the following:
- Maintain the cell line in medium containing Blasticidin
- Remember to freeze and store vials of early passage cells
References
- Ambros, V. (2001). MicroRNAs: Tiny Regulators with Great Potential. Cell 107, 823-826.
- Anandalakshmi, R., Pruss, G. J., Ge, X., Marathe, R., Mallory, A. C., Smith, T. H., and Vance, V. B. (1998). A Viral Suppressor of Gene Silencing in Plants. Proc. Natl. Acad. Sci. USA 95, 13079-13084.
- Andersson, S., Davis, D. L., Dahlbäck, H., Jörnvall, H., and Russell, D. W. (1989). Cloning, Structure, and Expression of the Mitochondrial Cytochrome P-450 Sterol 26-Hydroxylase, a Bile Acid Biosynthetic Enzyme. J. Biol. Chem. 264, 8222-8229.
- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1994). Current Protocols in Molecular Biology (New York: Greene Publishing Associates and Wiley-Interscience).
- Baer, M., Nilsen, T. W., Costigan, C., and Altman, S. (1990). Structure and Transcription of a Human Gene for H1 RNA, the RNA Component of Human RNase P. Nuc. Acids Res. 18, 97-103.
- Bernstein, E., Caudy, A. A., Hammond, S. M., and Hannon, G. J. (2001). Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference. Nature 409, 363-366.
- Bogenhagen, D. F., and Brown, D. D. (1981). Nucleotide Sequences in Xenopus 5S DNA Required for Transcription Termination. Cell 24, 261-270.
- Boshart, M., Weber, F., Jahn, G., Dorsch-Häsler, K., Fleckenstein, B., and Schaffner, W. (1985). A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus. Cell 41, 521-530.
- Bosher, J. M., and Labouesse, M. (2000). RNA Interference: Genetic Wand and Genetic Watchdog. Nature Cell Biol. 2, E31-E36.
- Brummelkamp, T. R., Bernards, R., and Agami, R. (2002). A System for Stable Expression of Short Interfering RNAs in Mammalian Cells. Science 296, 550-553.
- Calmels, T., Parriche, M., Burand, H., and Tiraby, G. (1991). High Efficiency Transformation of Tolypocladium geodes Conidiospores to Phleomycin Resistance. Curr. Genet. 20, 309-314.
- Carrington, J. C., and Ambros, V. (2003). Role of MicroRNAs in Plant and Animal Development. Science 301, 336-338.
- Chen, C., and Okayama, H. (1987). High-Efficiency Transformation of Mammalian Cells by Plasmid DNA. Mol. Cell. Biol. 7, 2745-2752.
- Chu, G., Hayakawa, H., and Berg, P. (1987). Electroporation for the Efficient Transfection of Mammalian Cells with DNA. Nucleic Acids Res. 15, 1311-1326.
- Ciccarone, V., Chu, Y., Schifferli, K., Pichet, J.-P., Hawley-Nelson, P., Evans, K., Roy, L., and Bennett, S. (1999). LipofectamineTM 2000 Reagent for Rapid, Efficient Transfection of Eukaryotic Cells. Focus 21, 54-55.
- Cogoni, C., and Macino, G. (1999). Gene Silencing in Neurospora crassa Requires a Protein Homologous to RNA-Dependent RNA Polymerase. Nature 399, 166-169.
- Cogoni, C., and Macino, G. (1997). Isolation of Quelling-Defective (qde) Mutants Impaired in Posttranscriptional Transgene-Induced Gene Silencing in Neurospora crassa. Proc. Natl. Acad. Sci. USA 94, 10233-10238.
- Cogoni, C., Romano, N., and Macino, G. (1994). Suppression of Gene Expression by Homologous Transgenes. Antonie Van Leeuwenhoek 65, 205-209.
- Cole, C. N., and Stacy, T. P. (1985). Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation. Mol. Cell. Biol. 5, 2104-2113.
- Curradi, M., Izzo, A., Badaracco, G., and Landsberger, N. (2002). Molecular Mechanisms of Gene Silencing Mediated by DNA Methylation. Mol. Cell. Biol. 22, 3157-3173.
- Drocourt, D., Calmels, T. P. G., Reynes, J. P., Baron, M., and Tiraby, G. (1990). Cassettes of the Streptoalloteichus hindustanus ble Gene for Transformation of Lower and Higher Eukaryotes to Phleomycin Resistance. Nucleic Acids Res. 18, 4009.
- Dykxhoorn, D. M., Novina, C. D., and Sharp, P. A. (2003). Killing the Messenger: Short RNAs that Silence Gene Expression. Nat. Rev. Mol. Cell Biol. 4, 457-467.
- Felgner, P. L., Holm, M., and Chan, H. (1989). Cationic Liposome Mediated Transfection. Proc. West. Pharmacol. Soc. 32, 115-121.
- Felgner, P. L. a., and Ringold, G. M. (1989). Cationic Liposome-Mediated Transfection. Nature 337, 387-388.
- Grishok, A., Pasquinelli, A. E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D. L., Fire, A., Ruvkun, G., and Mello, C. C. (2001). Genes and Mechanisms Related to RNA Interference Regulate Expression of the Small Temporal RNAs That Control C. elegans Developmental Timing. Cell 106, 23-34.
- Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000). An RNA-Directed Nuclease Mediates Genetic Interference in Caenorhabditis elegans. Nature 404, 293-296.
- Hannon, G. J. (2002). RNA Interference. Nature 418, 244-251.
- Hannon, G. J., Chubb, A., Maroney, P. A., Hannon, G., Altman, S., and Nilsen, T. W. (1991). Multiple cis-acting Elements are Required for RNA Polymerase III Transcription of the Gene Encoding H1 RNA, the RNA Component of Human RNase P. J. Biol. Chem. 266, 22796-22799.
- Hillen, W., and Berens, C. (1994). Mechanisms Underlying Expression of Tn10 Encoded Tetracycline Resistance. Annu. Rev. Microbiol. 48, 345-369.
- Hillen, W., Gatz, C., Altschmied, L., Schollmeier, K., and Meier, I. (1983). Control of Expression of the Tn10-encoded Tetracycline Resistance Genes: Equilibrium and Kinetic Investigations of the Regulatory Reactions. J. Mol. Biol. 169, 707-721.
- Hutvagner, G., McLachlan, J., Pasquinelli, A. E., Balint, E., Tuschl, T., and Zamore, P. D. (2001). A Cellular Function for the RNA-Interference Enzyme Dicer in the Maturation of the let-7 Small Temporal RNA. Science 293, 811-813.
- Jones, A. L., Thomas, C. L., and Maule, A. J. (1998). De novo Methylation and Co-Suppression Induced by a Cytoplasmically Replicating Plant RNA Virus. EMBO J. 17, 6385-6393.
- Ketting, R. F., Fischer, S. E., Bernstein, E., Sijen, T., Hannon, G. J., and Plasterk, R. H. (2001). Dicer Functions in RNA Interference and in Synthesis of Small RNA Involved in Developmental Timing in C. elegans. Genes Dev. 15, 2654-2659.
- Landy, A. (1989). Dynamic, Structural, and Regulatory Aspects of Lambda Site-specific Recombination. Ann. Rev. Biochem. 58, 913-949.
- Lee, R. C., Feinbaum, R. L., and Ambros, V. (1993). The C. elegans Heterochronic Gene lin-4 Encodes Small RNAs with Antisense Complementarity to lin-14. Cell 75, 843-854.
- Li, W. X., and Ding, S. W. (2001). Viral Suppressors of RNA Silencing. Curr. Opin. Biotechnol. 12, 150-154.
- McManus, M. T., Petersen, C. P., Haines, B. B., Chen, J., and Sharp, P. A. (2002). Gene Silencing Using Micro-RNA Designed Hairpins. RNA 8, 842-850.
- McManus, M. T., and Sharp, P. A. (2002). Gene Silencing in Mammals by Small Interfering RNAs. Nature Rev. Genet. 3, 737-747.
- Miller, J. H. (1972). Experiments in Molecular Genetics (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory).
- Mulsant, P., Tiraby, G., Kallerhoff, J., and Perret, J. (1988). Phleomycin Resistance as a Dominant Selectable Marker in CHO Cells. Somat. Cell Mol. Genet. 14, 243-252.
- Myslinksi, E., Ame, J. C., Krol, A., and Carbon, P. (2001). An Unusually Compact External Promoter for RNA Polymerase III Transcription of the Human H1RNA Gene. Nuc. Acids Res. 29, 2502-2509.
- Napoli, C., Lemieux, C., and Jorgensen, R. (1990). Introduction of a Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous Genes in trans. Plant Cell 2, 279-289.
- Nelson, J. A., Reynolds-Kohler, C., and Smith, B. A. (1987). Negative and Positive Regulation by a Short Segment in the 5´-Flanking Region of the Human Cytomegalovirus Major Immediate-Early Gene. Molec. Cell. Biol. 7, 4125-4129.
- Nykanen, A., Haley, B., and Zamore, P. D. (2001). ATP Requirements and Small Interfering RNA Structure in the RNA Interference Pathway. Cell 107, 309-321.
- Paddison, P. J., Caudy, A. A., Bernstein, E., Hannon, G. J., and Conklin, D. S. (2002). Short Hairpin RNAs (shRNAs) Induce Sequence-Specific Silencing in Mammalian Cells. Genes Dev. 16, 948-958.
- Paul, C. P., Good, P. D., Winer, I., and Engelke, D. R. (2002). Effective Expression of Small Interfering RNA in Human Cells. Nat. Biotechnol. 20, 505-508.
- Paule, M. R., and White, R. J. (2000). Transcription by RNA Polymerases I and III. Nuc. Acids Res. 28, 1283-1298.
- Perez, P., Tiraby, G., Kallerhoff, J., and Perret, J. (1989). Phleomycin Resistance as a Dominant Selectable Marker for Plant Cell Transformation. Plant Mol. Biol. 13, 365-373.
- Plasterk, R. H. A., and Ketting, R. F. (2000). The Silence of the Genes. Curr. Opin. Genet. Dev. 10, 562-567.
- Postle, K., Nguyen, T. T., and Bertrand, K. P. (1984). Nucleotide Sequence of the Repressor Gene of the Tn10 Tetracycline Resistance Determinant. Nuc. Acids Res. 12, 4849-4863.
- Rietveld, L. E., Caldenhoven, E., and Stunnenberg, H. G. (2002). In vivo Repression of an Erythroid-Specific Gene by Distinct Corepressor Complexes. EMBO J. 21, 1389-1397.
- Romano, N., and Macino, G. (1992). Quelling: Transient Inactivation of Gene Expression in Neurospora crassa by Transformation with Homologous Sequences. Mol. Microbiol. 6, 3343-3353.
- Shigekawa, K., and Dower, W. J. (1988). Electroporation of Eukaryotes and Prokaryotes: A General Approach to the Introduction of Macromolecules into Cells. BioTechniques 6, 742-751.
- Smith, C. J., Watson, C. F., Bird, C. R., Ray, J., Schuch, W., and Grierson, D. (1990). Expression of a Truncated Tomato Polygalacturonase Gene Inhibits Expression of the Endogenous Gene in Transgenic Plants. Mol. Gen. Genet. 224, 477-481.
- Sui, G., Soohoo, C., Affar, E. B., Gay, F., Shi, Y., Forrester, W. C., and Shi, Y. (2002). A DNA Vector-Based RNAi Technology to Suppress Gene Expression in Mammalian Cells. Proc. Natl. Acad. Sci. USA 99, 5515-5520.
- Takahashi, M., Degenkolb, J., and Hillen, W. (1991). Determination of the Equilibrium Association Constant Between Tet Repressor and Tetracycline at Limiting Mg2+ Concentrations: A Generally Applicable Method for Effector Dependent High Affinity Complexes. Anal. Biochem. 199, 197-202.
- van der Krol, A. R., Mur, L. A., Beld, M., Mol, J. N., and Stuitje, A. R. (1990). Flavonoid Genes in Petunia: Addition of a Limited Number of Gene Copies May Lead to a Suppression of Gene Expression. Plant Cell 2, 291-299.
- Voinnet, O., Pinto, Y. M., and Baulcombe, D. C. (1999). Suppression of Gene Silencing: A General Strategy Used by Diverse DNA and RNA Viruses of Plants. Proc. Natl. Acad. Sci. USA 96, 14147-14152.
- Weiss, B., Jacquemin-Sablon, A., Live, T. R., Fareed, G. C., and Richardson, C. C. (1968). Enzymatic Breakage and Joining of Deoxyribonucleic Acid. VI. Further Purification and Properties of Polynucleotide Ligase from Escherichia coli Infected with Bacteriophage T4. J. Biol. Chem. 243, 4543-4555.
- White, R. J. (1998). RNA Polymerase III Transcription (New York, NY: Springer-Verlag).
- Wigler, M., Silverstein, S., Lee, L.-S., Pellicer, A., Cheng, Y.-C., and Axel, R. (1977). Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells. Cell 11, 223-232.
- Yao, F., Svensjo, T., Winkler, T., Lu, M., Eriksson, C., and Eriksson, E. (1998). Tetracycline Repressor, tetR, Rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells. Hum. Gene Ther. 9, 1939-1950.
- Yu, J. Y., DeRuiter, S. L., and Turner, D. L. (2002). RNA Interference by Expression of Short-interfering RNAs and Hairpin RNAs in Mammalian Cells. Proc. Natl. Acad. Sci. USA 99, 6047-6052.
- Zamore, P. D. (2001). RNA Interference: Listening to the Sound of Silence. Nat. Struct. Biol. 8, 746-750.

