Related Product Information |
Introduction
Required Materials
Cells
- Human neural stem cells (e.g., Cat. no. N7800-100)
Reagents
- StemPro® NSC SFM (Cat. no. A10509-01)
- β-Mercaptoethanol (Cat. no. 21985)
- GlutaMAX™-I (Cat. no. 35050)
- CELLstart™ CTS™ (Cat. no. A10142-01)
- Fibronectin (Cat No. 33016-015)
- Water, distilled (Cat. no. 15230)
- Dulbecco’s Phosphate-Buffered Saline (D-PBS) without Ca2+ and Mg2+ (Cat. no. 14190)
- Dulbecco’s Phosphate-Buffered Saline (D-PBS) (Cat. no. 14040)
- StemPro® Accutase® Cell Dissociation Reagent(Cat. no. A11105)
- TrypLE™ Express Stable Trypsin Replacement Enzyme (Cat. no. 12604-013)
Preparing Media
StemPro® NSC SFM complete medium consists of KnockOut™ D-MEM/F-12 with StemPro® Neural Supplement, bFGF, EGF, and GlutaMAX™-I. Complete medium is stable for 4 weeks when stored in the dark at 2-8°C.
To prepare 100 mL of complete medium:
- Reconstitute bFGF and EGF with 0.1% BSA solution (in KnockOut™ D-MEM/F-12) at a concentration of 100 μg/mL. You will need 20 μL of each per 100 mL of complete medium. Freeze unused portions in aliquots.
- Mix the following components under aseptic conditions. For larger volumes, increase the component amounts proportionally.
| Component | Final concentration | Amount |
|---|---|---|
| KnockOut™ D-MEM/F-12 | 1X | 97 mL |
| GlutaMAX™-I Supplement | 2 mM | 2 mM |
| bFGF (prepared as 100 μg/mL stock) | 20 ng/mL | 20 ng/mL |
| EGF (prepared as 100 μg/mL stock) | 20 ng/mL | 20 μL |
| StemPro® Neural Supplement | 2% | 2 mL |
You may observe a white precipitate when thawing StemPro® Neural Supplement; this precipitate will disappear when the supplement is completely thawed or dissolved.
Preparing Matrix
Coating Culture Vessels with CELLstart™ CTS™
- Dilute CELLstart™ CTS™ 1:100 in D-PBS with calcium and magnesium (i.e., 50 μL of CELLstart™ CTS™ into 5 mL of D-PBS). Note: CELLstart™ CTS™ should not be frozen, vortex or exposed to vigorous agitation due to potential gel formation.
- Coat the surface of the culture vessel with the working solution of CELLstart™ CTS™ (14 mL for T-75, 7 mL for T-25, 3.5 mL for 60-mm dish, 2 mL for 35-mm dish).
- Incubate the culture vessel at 37°C in a humidified atmosphere of 5% CO2 for 1 hour.
- Remove the vessel from the incubator and store it until use. Remove all CELLstart™ CTS™ solution immediately before use, and fill the vessel with complete StemPro® NSC SFM. Note: You may coat the plates in advance and store them at 4°C, wrapped tightly with Parafilm®, for up to 2 weeks. Do not remove CELLstart™ CTS™ solution until just prior to use. Make sure the plates do not dry out.
Coating Culture Vessels with Fibronectin
- Dilute Fibronectin in distilled water to make a 1-mg/mL stock solution.
- Store working solution at -20°C until use.
- Add stock solution to D-PBS to make a working solution of 20 μg/mL.
- Add enough working solution to cover the surface of the culture vessel (10 mL for T-75, 2.5 mL for 60-mm dish, 1.5 mL for 35-mm dish).
- Incubate the culture vessel at 37°C in a humidified atmosphere of 5% CO2 for 1 hour.
- Remove the vessel from the incubator and store it until use. Remove Fibronectin solution immediately before use, and fill the vessel with complete StemPro® NSC SFM.
Note: You may store the Fibronectin-treated plates at 4°C, wrapped tightly with Parafilm®, for up to 2 weeks. Ensure that plates do not dry out. There is no washing step needed and use the dish directly after aspiration.
Culturing Neural Stem Cells
be passaged. Cells cultured during expansion can be frozen down to create additional frozen stocks of higher passage number.
Thawing Frozen Neural Stem Cells
- Prepare 10 mL of 1X KnockOut™ D-MEM/F-12 and warm to 37°C.
- Transfer vial of frozen NSC from nitrogen tank to water bath. It is important to make the transfer immediately to prevent crystal formation.
- Transfer thawed cells into a 15-mL tube and add warmed 1X KnockOut™ D-MEM/F-12 to 10 mL.
- Spin down the thawed cells by centrifugation at 1,000 rpm for 4 minutes. Aspirate and discard the supernatant.
- Resuspend the cells in StemPro® NSC SFM complete medium and plate on a CELLstart™ CTS™ or Fibronectin-coated plate at high density (1 × 105 cells/cm2).
Note: Viability of thawed cells should be ~80% if they were frozen following the cryopreservation protocol described here.
Passaging Neural Stem Cells (Adherent Culture)
- Aspirate the medium and wash with D-PBS without Ca2+ and Mg2+.
- Add 1 mL of TrypLE™ Express or StemPro® Accutase® to the culture vessel. Note: The monolayer lifts off from the culture dish within 30 seconds of application of TrypLE™ Express or StemPro® Accutase®.
- Gently pipette to loosen monolayer into a single cell suspension. Neutralize the treatment by adding 4 mL of medium. Do not treat the cells for longer than 3 minutes after addition of TrypLE™ Express or StemPro® Accutase®.
- Spin down the cells by centrifugation at 1,200 rpm for 4 minutes. Aspirate and discard the supernatant.
- Resuspend the cells in StemPro® NSC SFM complete medium.
- Count the cell number using a hemacytometer.
- Plate cells in fresh medium on a CELLstart™ CTS™- or Fibronectin-coated plate at a density of 1 × 104-1 × 105 cells/cm2, or split the cells at a 1:4 ratio.
Passaging Neural Stem Cells (Suspension Culture)
- Transfer medium containing neurospheres into a 15- or 50-mL conical tube.
- Leave the tube at room temperature and allow the neurosphere to settle to the bottom of tube. Alternatively, spin down the cells by centrifugation at 500 rpm (200 × g) for 2 minutes.
- Aspirate the supernatant carefully, and leave the neurospheres in a minimum volume of medium.
- Wash the neurospheres with 10 mL D-PBS without Ca2+ and Mg2+, aspirate the D-PBS supernatant carefully, and leave the neurospheres in a minimum volume of D-PBS.
- Add 1 mL of TrypLE™ Express to the spheres and gently triturate neurospheres using a Pasteur pipette to create a single cell suspension.
- Neutralize the treatment by adding 4 mL of medium.
- Spin down the cells by centrifugation at 1,200 rpm for 4 minutes. Aspirate and discard the supernatant.
- Resuspend the cells in StemPro® NSC SFM complete medium.
- Count cell number using hemacytometer.
- Seed the cells in fresh medium in a suspension dish (a non-coated flask can be used) at a density of 200,000 cells/mL.
Cryopreserving Neural Stem Cells
- Aspirate the medium and wash with D-PBS without Ca2+ and Mg2+.
- Add 1 mL of TrypLE™ Express to the culture vessel.
- Gently pipette to loosen monolayer into a single cell suspension. Neutralize the treatment by adding 4 mL of medium. Do not treat the cells for longer than 3 minutes after addition of TrypLE™ Express.
- Spin down the cells by centrifugation at 1,200 rpm for 4 minutes. Aspirate the supernatant.
- Resuspend the cells in StemPro® NSC SFM complete medium at a density of 2 × 106 cells/mL.
- Prepare freezing medium consisting of 20% DMSO and 80% medium. Note: Freezing medium (2X) can be prepared on the day of use and stored at 4°C until use.
- Add a volume of freezing medium equal to the amount of StemPro® NSC SFM complete medium used to resuspend the cells in a drop-wise manner.
- Prepare 1 mL aliquots (1 × 106 cells) in cryovials and place the vials in an isopropanol chamber.
- Put the isopropanol chamber at -80°C and transfer the vials to liquid nitrogen storage the next day.
Characterizing NSCs by Immunocytochemistry and PCR
Antibodies for NSC Characterization
Use the antibodies listed in the following table to characterize NSCs by immunocytochemistry.
| Category | Antigen | Type | Working concentration |
|---|---|---|---|
| Neural Stem Cells | Sox1 | Mouse IgG | 1:200 |
| Sox2 | Mouse IgG | 2 μg/mL | |
| CD133 | Rabbit IgG | 1:100 | |
| Proliferation | Ki67 | Rabbit IgG | 1:50 |
| EdU | Chemical | 1:1,000 | |
| Isotype Control | Mouse | IgM and IgG | Do not dilute |
| Rabbit | IgG | Do not dilute | |
| Rat | IgM and IgG | 1:50 |
Primers for NSC Characterization
| Target | Primer | Sequence | Tm | Amplicon size | Intron size |
|---|---|---|---|---|---|
| Neural Stem Cells | Sox1-F | GCGGAAAGCGTTTTCTTG | 53.0 | 406 | No Intron |
| Sox1-R | TGACTTCTCCTCCC | 50.2 | 406 | No Intron | |
| Sox2-F | ATGCACCGCTACGACGTGA | 59.3 | 437 | No Intron | |
| Sox2-R | CTTTTGCACCCCTCCCATTT | 56.0 | 437 | No Intron | |
| Nestin-F | CAGCGTTGGAACAGAGGTTGG | 58.6 | 389 | 1142 | |
| Nestin-R | TGGCACAGGTGTCTCAAGGGTAG | 60.7 | 389 | 1142 | |
| Endogenous Control | ACTB-F | ACCATGGATGATGATATCGC | 58.2 | 281 | 135 |
| ACTB-R | TCATTGTAGAAGGTGTGGTG | 54.4 | 281 | 135 |

