Cloning & Transformation

PCR Cloning Considerations

Nature of the Insert

The cloning of PCR-amplified fragments into a linear vector is typically a rapid and efficient process. However, not all PCR fragments will clone with the same efficiency into the same vector. These differences may be due to fragment size, insert toxicity, and the complexity of the insert. Inverted, AT-rich, or GC-rich repeats may contribute to the instability of the fragment as a cloned product in any vector (pCR®II, pCR®2.1, pcDNA™3.1, pUC18).

Insert Size

The size of the fragment being cloned is a primary contributor to the overall cloning efficiency. Large fragments of DNA (≥ 5 kb) are amenable to cloning in high-copy number vectors, yet at a much lower efficiency.

Vector-to-Insert Ratio

Optimization of molar concentration ratios of the vector to insert is critical to ensure efficient cloning. Successful cloning ratios may range from 1:1 to 1:10. One common strategy for determining the optimal ratio is by preparing several vector: insert ratios: 1:1, 1:3, and 1:5. While these ratios may not be ideal for all cloning events, they are useful for most cloning needs. For example, if the vector is 3 kb and the insert is 1 kb, one-third the amount of insert needs to be added to attain a 1:1 molar ratio. When performing TOPO® -TA or Directional TOPO® Cloning, optimal results are achieved most often when using a 1:10 dilution of the PCR product.

Fresh PCR Product

The use of fresh PCR products in TA, TOPO® TA, and Directional TOPO® Cloning is recommended due the potential presence of exonucleases that will, over time, degrade the nucleotide overhangs, reducing the efficiency of the cloning event. While it is not recommended, some PCR products have been successfully cloned after 1 week of storage at +4°C.

Importance of Positive and Negative Controls

In any cloning experiment, the use of positive and negative controls is important. Without appropriate positive and negative controls for your cloning and transformation reactions, it is very difficult to evaluate the results of a cloning event. These controls are indicators of enzyme activity in DNA preparation and transformation efficiency of competent cells. Troubleshooting is virtually impossible without any controls. To ensure the efficiency of the cloning reaction, each of Invitrogen’s kits includes controls.

Compatibility of DNA Ends of Vector and Insert

TA Cloning® technology was designed to clone PCR products produced by Taq polymerase. It takes advantage of the terminal transferase activity of this polymerase which adds a single 3’-A overhang to each end of the PCR product. Blunt cloning vectors and directional TOPO® cloning technologies are designed to clone PCR products produced by proofreading polymerases. Successful cloning depends upon using the correct polymerase with your cloning vector.

Addition of 3’-A Overhangs Following PCR Amplification

Direct cloning of DNA amplified by proofreading polymerases into TA Cloning®or TOPO TA Cloning® vectors is often difficult because of very low cloning efficiencies. This is because proofreading polymerases possess 3´→5´ exonuclease activity that removes the 3´-A overhangs necessary for TA Cloning® and TOPO TA Cloning®. A simple procedure to add 3´ adenines to blunt-end fragments is provided below. Other protocols may be suitable.

You will need the following items:

  • Taq polymerase
  • A heat block equilibrated to 72°C
  • Phenol-chloroform
  • 3 M sodium acetate
  • 100% ethanol
  • 80% ethanol
  • TE buffer

  1. After amplification with a proofreading polymerase, place samples on ice and add 0.7-1 unit of Taq polymerase per tube. Mix well. It is not necessary to change the buffer or remove the proofreading polymerase. A sufficient number of PCR products will retain the 3´-A overhangs.

  2. Incubate at 72°C for 8-10 minutes (do not cycle).

  3. Place on ice and use immediately in a TA Cloning® or TOPO TA Cloning® reaction. If you wish to store your reaction, continue to Step 4.

  4. Extract reaction immediately with an equal volume of phenol-chloroform. This removes all of the polymerases.

  5. Precipitate the DNA by adding 1/10 volume of 3 M sodium acetate and 2X volume of 100% ethanol.

  6. Centrifuge at maximum speed (14,000 rpm in a microcentrifuge) for 5 minutes at room temperature to pellet the DNA.

  7. Remove the ethanol, rinse the pellet with 80% ethanol, and allow to air dry.

  8. Resuspend the pellet in TE buffer to the starting volume of the PCR amplification reaction. The PCR amplification product is now ready for ligation into the TA Cloning® or TOPO TA Cloning® vector.

Note:   If you have more than one PCR product, you may wish to gel-purify your fragment using the S.N.A.P.™ MiniPrep Kit. After purification, add Taq polymerase buffer, dATP, and 0.5 unit of Taq polymerase, and incubate 10-15 minutes at 72°C. Proceed directly to the cloning reaction.

Designing the Forward PCR Primer for Directional TOPO®Cloning

Successful directional TOPO® Cloning depends on the design of the forward PCR primer and, to a lesser extent, on the design of the reverse PCR primer. To clone directionally, the forward PCR primer must contain a simple Kozak sequence (CACCATG) at the 5´ end of the primer. The four nucleotides, CACC, base pair with the overhang sequence, GTGG. The bold ATG is the initiation codon of your protein of interest.

Designing the Reverse PCR Primer

To ensure that your ORF clones directionally with high efficiency, the reverse PCR primer must not be complementary to the overhang sequence GTGG at the 5´ end. A one base pair mismatch will reduce the directional cloning efficiency to 75%, and may result in your ORF being cloned in the opposite orientation. We have not observed any evidence of PCR products cloning in the opposite orientation because of a two base pair mismatch, but this has not been tested directly. Other options to consider are listed in Table 1.

Table 1 - Options to consider when designing the reverse PCR primer
 
Option Action
Include the C-terminal tag encoded by the vector Design your reverse PCR primer so that your ORF is in frame with the C-terminal tag and does not contain a stop codon
Omit the C-terminal tag encoded by the vector Design your reverse PCR primer to include a stop codon or design it to anneal downstream of the native stop codon
Use another C-terminal tag Design your reverse PCR primer to contain the tag of interest and include a stop codon to prevent inclusion of the C-terminal tag
Secrete your PCR product using mammalian or insect Gateway®native expression vectors Use the pENTR™/D-TOPO® vector and include the appropriate secretion signal

In addition to the major considerations above, you may have other options to consider depending on the directional cloning vector you are using. Please refer to the respective manuals for detailed information.
 

Transformation Considerations

Competent Cells

The competence of a microorganism is dependent on its ability to uptake recombinant DNA and survive the introduction of foreign DNA into the cell. Different organisms vary in these capacities, however the basic principles of introduction are the same. Modifications to the cell membrane/wall of microorganisms must occur often, using either chemical modification or electric shock. After this damage, cells are recovered and calculated for their “uptake” efficiency—measured as colony forming units per microgram of DNA (cfu/μg). Some common transformation efficiencies are listed below in Table 1.
 
Table 1 - Transformation efficiencies (cfu/μg)
 

Chemically Competent Electrocompetent
E. coli
 1.0 x 106 to 5.0 x 109 1.0 x 108 to 2.0 x 1010
S. cerevisiae
1.0 x 103 to 2.2 x 107 1.0 x 105 to 1.0 x 107
S. pombe
1.0 x 103 to 1.0 x 106 1.0 x 105 to 1.0 x 106
P. pastoris
1.0 x 102 to 1.0 x 105 1.0 x 104 to 1.0 x 105

Transformation Method

Invitrogen offers chemically competent and electrocompetent E. coli. Chemically competent E. coli have a fragile cell wall which make cells prepared in this manner incompatible with electrocompetent transformation methods where a high-energy field is applied to the cells/DNA mixture. Likewise, Invitrogen’s electrocompetent E. coli are not transformable with any heat-shock transformation technique.

Rapid Transformation Procedure for Use with TOPO® Vectors

Recommended only for transformations using ampicillin selection.

  1.    Add 4 μl of the TOPO® Cloning reaction to one vial of One Shot® Chemically Competent E. coli and mix gently.

  2.    Incubate on ice for 5 minutes.

  3.    Spread 50 μl of cells on a pre-warmed LB plate (containing ampicillin and X-gal) and incubate overnight at 37°C

Sequencing Primers

Primer Sequence Application
3´ AOX1 Pichia  5´d[GCAAATGGCATTCTGACATCC]3´  Primer for sequencing from any Pichia expression vector which contains the 3´AOX1 transcription termination sequence. 21mer. 
5´ AOX1 Pichia  5´d[GACTGGTTCCAATTGACAAGC]3´  Forward primer for sequencing from any Pichia expression vector which contains the 5´AOX1 sequence. 21mer. 
Ac5 Forward  5´d[ACACAAAGCCGCTCCATCAG]3´  Forward primer for sequencing from the pAc5.1/V5-His A, B, & C vectors. 20mer. 
a-Factor  5´d[TACTATTGCCAGCATTGCTGC]3´  Forward primer for sequencing from pPIC9, pPIC9K, pPICZa, and pGAPZa Pichia expression vectors. 21mer. 
AUG1 Forward  5´d[CAATTTACATCTTTATTTATTAACG]3´  Forward primer for sequencing Pichia methanolica expression vectors containing the AUG1 promoter. 25mer. 
AUG1 Reverse  5´d[GAAGAGAAAAACATTAGTTGGC]3´  Reverse primer for sequencing Pichia methanolica expression vectors containing the AUG1 promoter. 22mer. 
Baculovirus (+15) Reverse  5´d[ACTTCAAGGAGAATTTCC]3´  Reverse primer for sequencing from the pBlueBac4.5, pBlueBacHis2, and pMelBac vectors. 18mer. 
BGH Reverse  5´d[TAGAAGGCACAGTCGAGG]3´  Reverse primer for sequencing from vectors which contain the BGH polyadenylation sequence. 18mer. 
cI Forward  5´d[GGATAGCGGTCAGGTGTT]3´  Forward primer for sequencing from the pHybcI/HK vector. 18mer. 
CMV Forward  5´d[CGCAAATGGGCGGTAGGCGTG]3´  Forward primer for sequencing from vectors with the human CMV immediate early promoter. 21mer. 
CYC1 Reverse  5´d[GCGTGAATGTAAGCGTGAC]3´  Reverse primer for sequencing vectors with the CYC1 transcription termination signal. 19mer. 
EBV Reverse  5´d[GTGGTTTGTCCAAACTCATC]3´  Reverse primer for sequencing from all EBV vectors. 20mer. 
Ecdysone Forward  5´d[CTCTGAATACTTTCAACAAGTTAC]3´  Forward primer for sequencing from the pIND or pIND(SP1) expression vectors. 24mer. 
EF-1a Forward  5´d[TCAAGCCTCAGACAGTGGTTC]3´  Forward primer for sequencing from vectors with the human translation elongation factor-1a (EF-1a) promoter. 21mer. 
GAL1 Forward  5´d[AATATACCTCTATACTTTAACGTC]3´  Forward primer for sequencing from vectors with the S. cerevisiae GAL1 promoter. 24mer. 
M13 Forward (-20)  5´d[GTAAAACGACGGCCAG]3´  Universal forward primer for sequencing from any vector containing the N-terminal coding sequence of the lacZ gene. 16mer. 
M13 Forward (-40)  5´d[GTTTTCCCAGTCACGAC]3´  Universal forward primer for sequencing from any vector containing the N-terminal coding sequence of the lacZ gene. 17mer. 
M13 Reverse  5´d[CAGGAAACAGCTATGAC]3´  Universal reverse primer for sequencing from any vector containing the N-terminal coding sequence of the lacZ gene. 17mer. 
M13/pUC Forward  5´d[CCCAGTCACGACGTTGTAAAACG]3´  Forward primer for sequencing from recombinant bacmid in Bac-to-Bac® Baculovirus expression system. 23mer. 
M13/pUC Reverse  5´d[AGCGGATAACAATTTCACACAAGG]3´  Reverse primer for sequencing from recombinant bacmid in Bac-to-Bac® Baculovirus expression system. 23mer. 
MT Forward  5´d[CATCTCAGTGCAACTAAA]3´  Forward primer for sequencing from the pMT/V5-His or pMT/BiP/V5-His vectors. 18mer. 
OpIE2 Forward  5´d[CGCAACGATCTGGTAAACAC]3´  Forward primer for sequencing InsectSelect™ vectors containing a single copy of the OpIE2 promoter. 20mer. 
OpIE2 Reverse  5´d[GACAATACAAACTAAGATTTAGTCAG]3´  Reverse primer for sequencing InsectSelect™ vectors containing the OpIE2 polyadenylation sequence. 26mer. 
pBAD Forward  5´d[ATGCCATAGCATTTTTATCC]3´  Forward primer for sequencing from vectors with the E. coli araBAD promoter. 20mer. 
pBAD Reverse  5´d[GATTTAATCTGTATCAGG]3´  Reverse primer for sequencing from vectors with the E. coli araBAD promoter. 18mer. 
pCEP Forward  5´d[AGAGCTCGTTTAGTGAACCG]3´  Forward primer for sequencing from the pCEP4 vector. 20mer. 
pGAP Forward  5´d[GTCCCTATTTCAATCAATTGAA]3´  Forward primer for sequencing from the glyceraldehyde-3-phosphate dehydrogenase promoter of the pGAPZ and pGAPZa vectors. 22mer. 
pGENE Forward  5´d[CTGCTATTCTGCTCAACCT]3´  Forward primer for sequencing from the pGene/V5-His expression vector. 19mer. 
pHybLex/Zeo Forward  5´d[AGGGCTGGCGGTTGGGGTTATTCGC]3´  Forward primer for sequencing from the pHybLex/Zeo vector. 25mer. 
pHybLex/Zeo Reverse  5´d[GAGTCACTTTAAAATTTGTATACAC]3´  Reverse primer for sequencing from the pHybLex/Zeo vector. 25mer. 
pJG4-5 Forward  5´d[GATGCCTCCTACCCTTATGATGTGCC]3´  Forward primer for sequencing from the pJG4-5 vector. 26mer. 
pJG4-5 Reverse  5´d[GGAGACTTGACCAAACCTCTGGCG]3´  Reverse primer for sequencing from the pJG4-5 vector. 24mer. 
Polyhedrin Forward  5´d[AAATGATAACCATCTCGC]3´  Forward primer for sequencing from any baculovirus transfer vector containing the polyhedrin promoter. 18mer. 
Polyhedrin Reverse  5´d[GTCCAAGTTTCCCTG]3´  Reverse primer for sequencing from any baculovirus transfer vector containing the polyhedrin promoter. 15mer. 
pREP Forward  5´d[GCTCGATACAATAAACGCC]3´  Forward primer for sequencing from the pREP4 vector. 19mer. 
pRH Forward  5´d[CTGTCTCTATACTCCCCTATAG]3´  Forward primer for sequencing from the pRH5´or pRH3´ vectors. 22mer. 
pRH Reverse  5´d[CAAAATTCAATAGTTACTATCGC]3´  Reverse primer for sequencing from the pRH5´or pRH3´ vectors. 22mer. 
pTrcHis Forward  5´d[GAGGTATATATTAATGTATCG]3´  Forward primer for sequencing from the pTrcHis A, B, & C, pTrcHis2 A, B, & C, pTrcHis-TOPO®, and pTrcHis2-TOPO® vectors. 21mer. 
pTrcHis Reverse  5´d[GATTTAATCTGTATCAGG]3´  Reverse primer for sequencing from the pTrcHis A, B, & C, pTrcHis2 A, B, & C, pTrcHis-TOPO®, and pTrcHis2-TOPO® vectors. 18mer. 
pUni Forward  5´d[CTATCAACAGGTTGAACTG]3´  Forward primer for sequencing from the pUni vectors. 19mer. 
pUni Reverse  5´d[CAGTCGAGGCTGATAGCGAGCT]3´  Reverse primer for sequencing from the pUni vectors. 22mer. 
pYESTrp Forward  5´d[GATGTTAACGATACCAGCC]3´  Forward primer for sequencing from the pYESTrp or pYESTrp2 vectors. 19mer. 
pYESTrp Reverse  5´d[GCGTGAATGTAAGCGTGAC]3´  Reverse primer for sequencing from the pYESTrp or pYESTrp2 vectors. 19mer. 
Sp6 Promoter  5´d[GATTTAGGTGACACTATAG]3´  Universal primer for sequencing from most Sp6 primer sites. 19mer. 
T3 Promoter  5´d[ATTAACCCTCACTAAAGGGA]3´  Universal primer for sequencing from most T3 primer sites. 20mer. 
T7 Promoter  5´d[TAATACGACTCACTATAGGG]3´  Universal primer for sequencing from most T7 primer sites. 20mer. 
T7 Reverse  5´d[TAGTTATTGCTCAGCGGTGG]3´  Reverse primer for sequencing from T7 expression vectors. 20mer. 
V5 Reverse  5´d[ACCGAGGAGAGGGTTAGGGAT]3´  Reverse primer for sequencing from vectors encoding the C-terminal V5 epitope. 21mer. 
Xpress™ Forward  5´d[TATGGCTAGCATGACTGGT]3´  Forward primer for sequencing from vectors encoding the Xpress™ epitope. 19mer. 

Troubleshooting

Transformation Problem Possible Cause Solution
Low transformation efficiency  Impurities in the DNA  For chemically competent cells, remove phenol, proteins, detergents, and ethanol from the DNA solution. For electrotransformable cells, ethanol precipitate ligations to clean up plasmid DNA, since salt and buffers severely inhibit electroporation and increase the risk of arcing. In addition, dissolve the DNA in sterile water or 0.5X TE (5 mM Tris-HCl, 0.5 mM EDTA). 
Low transformation efficiency  Excess DNA or volume  Add 1 to 10 ng of DNA in no more than a 5-µl volume per 100 µl of chemically competent cells. For Subcloning Efficiency™ cells, use 1 to 3 µl per 50 µl of competent cells. For ElectroMAX™ cells, add 1 µl (1 to 50 ng) to 20 to 25 µl of cells. 
Low transformation efficiency  Inhibition of transformation by ligation  For One Shot®, MAX Efficiency®, Library Efficiency® and Subcloning Efficiency™ cells, dilute the ligation reaction mix 5 times with 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA before adding to competent cells. For UltraMAX™ cells and when using MAX Efficiency® cells for library construction, add = 5 µl of undiluted DNA to 100 µl of cells. 
Low transformation efficiency  Poor expression of antibiotic resistance  Use S.O.C. medium for expression. Transformation efficiency decreases 2- to 3-fold if expression is performed in LB medium. For Stbl4™ cells and Stbl2™ cells, express for 90 min. instead of 60 min., since the expression is performed at 30°C. 
Low transformation efficiency  Improper storage of competent cells  Store at -80°C. Invitrogen electrotransformable and chemically competent cells are stable for up to 2 years. Do not store cells in liquid nitrogen. Minimize the number of freeze-thaw cycles. Aliquot and refreeze any unused cells. Note, however, it will lower transformation efficiencies. 
Low transformation efficiency  Improper handling of competent cells  Thaw competent cells on ice, and use cells immediately upon thawing. Do not vortex. 
Low transformation efficiency  Improper heat-shock procedure for chemically competent cells  For One Shot®, UltraMAX™, MAX Efficiency®, and Library Efficiency® cells, incubate cells at 42°C for 45 sec. without shaking. These conditions are optimized for round-bottom polypropylene tubes (17 to 100 mm) and 100 µl of cells. For Subcloning Efficiency™ cells, incubate cells at 37°C for 20 sec. using 1.5-ml microcentrifuge tubes and 50 µl of cells. For Stbl2™ cells, heat at 42°C for 25 sec. instead of 45 sec. • If there is a change in the tubes or volume of cells, the heat shock conditions must be optimized. 
Low transformation efficiency  Improper electroporation  Use devices that apply 16 kV/cm and the appropriate conditions for each electrocompetent strain. 
Low transformation efficiency  Slow or no growth of cells  If cells are being grown at 30°C instead of 37°C, incubate for at least 90 min. during recovery and incubate the transformed colonies longer. 
Low transformation efficiency  Overgrowth (little or no selection)  Be certain that the correct antibiotic is used. Ensure that the correct concentration of antibiotic is used. See recommended usage on page XX. Use fresh antibiotics—make sure the drug is not expired. 
Low transformation efficiency  Calculations performed improperly  Be certain that correct dilution factors and DNA amounts are used to calculate efficiency. 

Antibiotics

Antibiotics Ecoli Scerevisiae Ppastoris Yeast General Mammalian Insect
Actinomycin          2-5 ug/ml   
Ampicillin  25-100 ug/ml           
Blasticidin  50 ug/ml  5-100 ug/ml  250-300 ug/ml    2-25 ug/ml  10-80 ug/ml 
Carbenicillin  10-50 ug/ml           
Chloramphenicol  25-170 ug/ml           
Gentamicin  5-50 ug/ml        35 ug/ml  10 ug/ml 
Hygromycin  20-200 ug/ml  50 ug/ml      50-200 ug/ml   
Kanamycin  10-50 ug/ml      10-50 ug/ml     
Neomycin        200-300 ug/ml  50-2500 ug/ml  500-700 ug/ml 
Spectinomycin  100 ug/ml           
Streptomycin  50-100 ug/ml           
Tetracycline  10-50 ug/ml        1 ug/ml for induction   
Zeocin  25-50 ug/ml  50-300 ug/ml  300 ug/ml    5-50 ug/ml  300-600 ug/ml 

Yeast Genotypes

Strain Genotype
BY4730  MATα leu2-∆0 met15-∆0 ura3-∆0 
BY4739  MATα leu2-∆0 lys2-∆0 ura3-∆0 
BY4741  MATα his3-∆1 leu2-∆0 met15-∆0 ura3-∆0 
BY4742  MATα his3-∆1 leu2-∆0 lys2-∆0 ura3-∆0 
BY4743  4741/4742 
EBY100  MATα ura3-52 trp1 leu2∆1 his3∆200 pep4::HIS3 prb1∆1.6R can1 GAL (pIU211: URA3) 
EGY191  MATα ura3 trp1 his3 2lexAop-LEU2 
EGY191/pSH18-34  MATα ura3 trp1 his3 2lexAop-LEU2 {pSH18-34: URA3 8lexAop-lacZ} 
EGY48  MATα ura3 trp1 his3 6lexAop-LEU2 
EGY48/pSH18-34  MATα ura3 trp1 his3 6lexAop-LEU2 {pSH18-34: URA3 8lexAop-lacZ} 
GS115  his4 
INVSc1  MATα/MATa his3∆1/his3∆1 leu2/leu2 trp1-289/trp1-289 ura3-52/ura3-52 
KM71  his4 aox1::ARG4 arg4 
KM71H  aox1::ARG4 arg4 
L40   MATa his3∆200 trp1-901 leu2-3112 ade2 LYS2::(4lexAop-HIS3) URA3::(8lexAop-lacZ) GAL4 
L40-ura3  MATα ura3-52 leu2-3112 his3 .200 trp1 .1ade2 LYS2::(LexA op)4-HIS3 ura3::(LexA-op)8-lacZ 
L40uraMS2  MATa ura3-52 leu3-3112 his3∆200 trp1∆l ade2 LYS2::(4lexAop-HIS3) ura3::(8lexAop-lacZ) {pLexA/MS2/Zeo (Zeocin™)} 
PMAD11  ade2-11 
PMAD16  ade2-11 pep4 prb1 
SKY191  MATα ura3 trp1 his3 2lexAop-LEU2 3cIop-LYS2 
SKY48  MATα ura3 trp1 his3 6lexAop-LEU2 3cIop-LYS2 
SKY48/pLacGUS  MATα ura3 trp1 his3 6lexAop-LEU2 3cIop-LYS2 {pLacGUS: URA3 3cIop-gusA 8lexAop-lacZ} 
SMD1168  pep4 his4 
SMD1168H  pep4 
TCP  h- leu1-32 
X-33  wild-type 

Key Genotype

Genotype Description
ara-14  Blocks arabinose catabolism 
argF  Ornithine carbamoyltransferase mutation blocks ability to use arginine 
dam/dcm  Abolishes endogenous adenine methylation at GATC sequences (dam) or cytosine methylation at CCWGG sequences (dcm). Used to propagate DNA for cleavage with certain restriction enzymes (e.g. Ava II, Bcl I) 
DE3  Lysogen that encodes T7 RNA polymerase. Used to induce expression in T7-driven expression systems 
endA  endA Mutation in the non-specific endonuclease Endonuclease I; eliminates non-specific endonuclease activity, resulting in improved plasmid preps 
F´   A self-transmissible, low-copy plasmid used for the generation of single-stranded DNA when infected with M13 phage; may contain a resistance marker to allow maintenance and will often carry the lacI and lacZ∆M15 genotypes 
galK  Galactokinase mutation blocks catabolism of galactose—cells that are galK minus grow in the presence of galactose as the sole carbon source 
galU  Glucose-1-phosphate uridylyltransferase mutation blocks ability to use galactose—cells that are galU minus can grow on media that contains galactose as the sole carbon source 
gyrA96   DNA gyrase mutant produces resistance to nalidixic acid 
hsd   Mutations in the system of methylation and restriction that allow E. coli to recognize DNA as foreign. The hsd genotype allows efficient transformation of DNA generated from PCR reactions *hsdR–eliminates restriction of unmethylated EcoK I sites. (1) **hs 
lacI   Encodes the lac repressor that controls expression from promoters that carry the lac operator; IPTG binds the lac repressor and derepresses the promoter; often used when performing blue/white screening or to control expression of recombinant genes 
lacY1   Blocks use of lactose via β-D-galactosidase mutant 
lacZ   β-D-galactosidase gene; mutations yield colorless (vs. blue) colonies in the presence of X-gal 
lacZ∆M15   Element required for β-galactosidase complementation when plated on X-gal; used in blue/white screening of recombinants; usually carried on the lambdoid prophage φ80 or F´ 
leuB   Requires leucine for growth on minimal media via β-isopropyl malate dehydrogenase mutation 
lon   lon Deficiency in the Lon ATPase-dependent protease; decreases the degradation of recombinant proteins; all B strains carry this mutation 
mcrA, mcrBC,or mrr  Mutations that allow methylated DNA to not be recognized as foreign; this genotype is necessary when cloning genomic DNA or methylated cDNA  
nupG   Mutation for the transport of nucleosides 
ompT   Indicates that the E. coli lack an outer membrane protease—reduces degradation of heterologous the strains and recovery of intact recombinant proteins is improved in ompT minus strains 
P3   A 60-kb low-copy plasmid that carries the ampicillin and tetracycline resistance genes with amber mutations; used predominantly for selection of supF-containing plasmids; carries the kanamycin resistance gene for selection 
pLys   pLys Plasmid that encodes T7 lysozyme; used to reduce basal expression in T7-driven expression systems by inhibiting basal levels of T7 RNA polymerase 
proAB   proAB Requires proline for growth on minimal media 
recA   Mutation in a gene responsible for general recombination of DNA; particularly desirable when cloning genes with direct repeats 
relA   RNA is synthesized in absence of protein synthesis (relaxed phenotype) relA locus regulates the coupling between transcription and translation. In the wild type, limiting amino acid concentrations results in the shutdown of RNA synthesis (also known as th 
rpsL  Confers resistance to streptomycin (this makes a mutant ribosomal protein, small subunit, the target of the drug) 
supE,F  tRNA glutamine suppressor of amber (supE)(UAG) or tyrosine (supF) 
thi-1   Requires thiamine for growth on minimal media 
Tn10   Confers tetracycline resistance via a transposon 
tonA  Confers resistance to the lytic bacteriophage T1, T5 and f80 
traD, D36   Prevents transfer of F' episome via transfer factor mutation 
tsx   Confers resistance to phage T6 and colicin K 
xyl-5   Blocks catabolism of xylose 

Compatible Restriction Ends

Protruding End Unambiguous Ambiguous
5´-AATT  Apo I EcoR I Mun I Tsp 509 I   
5´-AGCT  Hind III   
5´-CATG  BspLU11 I Nco I Rca I  Afl III, BsaJ I,Dsa I, Sty I 
5´-CCGG  Cfr 10 I, Kpn2 I, PinA I, SgrA I, Xma I  Ava I, BsaJ I 
5´-CG  Aci I, BsaH I, Cla I, HinP1 I , Hpa II , Mae II, Msp I, Nar I, Nsp V, Psp1406 I, Taq I  Acc I 
5´-CGCG  Asc I, Bss H II, Mlu I  Afl III, BsaJ I, Dsa I 
5´-CTAG  Avr II, Nhe I, Spe I, Xba I  BsaJ I, Sty I 
5´-GATC  BamH I, Bcl I, Bgl II, Bsp1407 I, Bst Y I, Mbo I, Nde II, Sau 3A I   
5´-GGCC  Eae I, Not I, Xma III   
5´-GTAC  Asp718 I, Sun I  Ban I 
5´-GTCAC    Tsp 45 I 
5´-GTGAC    Tsp 45 I 
5´-TA  Mae, Mse I, Nde I, Vsp I   
5´-TCGA  Sal I, Xho I  Ava I 
5´-TGCA  Alw 44 I  Sfc I 
5´-TTAA  Afl II   
ACGT-3´  Aat II   
AGCT-3´  Sst I  Alw21 I, Ban II 
AT-3´  Pac I, Pvu I   
ATC-3´  Sgf I   
CATG-3´  Nla III, Nsp I, Sph I   
CG-3´  Hha I   
GC-3´  Sst II   
GCGC-3´  Bbe I, Hae II   
GGCC-3´  Apa I, Fse I  Ban II, Sdu I 
GTAC-3´  Kpn I   
TGCA-3´  Nsi I, Pst I, Sse8387 I  Alw 21, I Sdu I 

E Coli Genotype

Strain Genotype
BL21 Star™(DE3)  F- ompT hsdSB (rB-, mB-) gal dcm rne131 (DE3) 
BL21 Star™(DE3)pLysS  F- ompT hsdSB (rB-, mB-) gal dcm rne131 (DE3) pLysS (CamR) 
BL21(DE3)  F- ompT hsdSB (rB-, mB-) gal dcm (DE3) 
BL21(DE3)pLysE  F- ompT hsdSB (rB-, mB-) gal dcm (DE3) pLysE (CamR) 
BL21(DE3)pLysS  F- ompT hsdSB (rB-, mB-) gal dcm (DE3) pLysS (CamR) 
BL21-AI™   F- ompT hsdSB(rB-, mB-) gal dcm araB::T7 RNAP-tetA 
BL21-SI™  F- ompT hsdSB(rB-, mB-) gal dcm endA1 lon- proUp::T7 RNAP::malQ-lacZ (TetS) 
DB3.1™  F- gyrA462 endA ∆(sr1-recA) mcrB mrr hsdS20 (rB-, mB-) supE44 ara14 galK2 lacY1 proA2 rpsL20(Smr ) xyl5 ∆leu mtl1 
DH10Bac™  F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 endA1 recA1 ∆(ara, leu)7697 araD139 galU galK, nupG rpsL λ- 
DH10B™  F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galK rpsL(StrR) endA1 nupG 
DH10B™-T1R  F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 endA1 araD139 ∆(ara, leu)7697 galU galK λ- rpsL nupG tonA 
DH12S™  F´ {proAB+ lacIqZ∆M15 Tn10(TetR)} φ80lacZ∆M15 recA1 ∆(mcr-hsdRMS-mcrBC) ∆lacX74 ∆(ara-leu)7697 araD139 galU galK nupG rpsL relA1 
DH5α-E™  F- φ80lacZ∆M15 ∆(lacZYA-argF) U169 endA1 recA1 hsdR17 (rk-, mk+) thi-1 phoA supE44 λ- gyrA96 relA1 gal- 
DH5αF´IQ™  F´ proAB+ lacIqZ∆M15 zzf::Tn5 (KmR) φ80lacZ∆M15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ-thi-1 gyr96 relA1 
DH5α-FT™  F´ proAB+ lacIqZ∆M15 Tn10(TetR) φ80lacZ ∆M15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ-thi-1gyrA96 relA1 
DH5αMCR™  F- mcrA ∆(mcr-hsdRMS-mcrBC) φ80lacZM15 (lacZYA-argF) U169 endA1 recA1 supE44 thi-1 gyrA96 relA1 
DH5α™  F- φ80lacZ∆M15 ∆(lacZYA-argF) U169 endA1 recA1 hsdR17 (rk-, mk+) supE44 thi-1 gyrA96 relA1 phoA 
DH5α™-T1R:  F- φ80lacZM15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 phoA tonA 
GeneHogs®  F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG fhuA::IS2 
GI698 and GI724  F - λ- lacIq lacPL8 ampC::Ptrp cI Note: GI698 has no ribosome binding site before the cI repressor gene, causing decreased production of cI repressor, when compared to GI724. 
INV110  F´ {traD36 proAB+ lacIq lacZ∆M15} rpsL (StrR) thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 ∆(lac-proAB) ∆(mcrC-mrr)102::Tn10 (TetR) 
INVαF´  F´ endA1 recA1 hsdR17 (rk-, mk+) supE44 thi-1 gyrA96 relA1 φ80lacZ∆M15 ∆(lacZYA-argF) U169 
LMG194  F- ∆lacX74 galE thi rpsL ∆phoA (Pvu II) ∆ara714 leu::Tn10 (TetR) 
Mach1™-T1R  F´ φ80(lacZ)∆M15 ∆lacX74 hsdR(rk-, mk+) ∆recA1398 endA1 tonA 
MC1061/P3  F- hsdR (rk-, mk+) araD139 ∆(araABC-leu)7679 galU galK ∆lacX74 rpsL (StrR) thi mcrB {P3: KanR AmpR (am) TetR (am)} 
OmniMAX™-T1R  F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80(lacZ)∆M15 ∆(lacZYA-argF) U169 endA1 recA1 supE44 thi-1 gyrA96 relA1 tonA panD/F' proAB+ lacIq lacZ∆M15 Tn10 (TetR) 
PIR1  F- ∆lac169 rpoS(am) robA1 creC510 hsdR514 endA recA1 uidA(∆Mlu I)::pir-116 
PIR2  F- ∆lac169 rpoS(am) robA1 creC510 hsdR514 endA recA1 uidA(∆Mlu I)::pir 
Stbl2™  F- mcrA ∆(mcrBC-hsdRMS-mrr) recA1 endA1 lon gyrA96 thi-1 supE44 relA1 λ- ∆(lac-proAB) 
Stbl4™  F´ proAB+ lacIqZ∆M15 Tn10(TetR) λ- mcrA ∆(mcrBC-hsdRMS-mrr) recA1 endA1 gal supE44 gyrA96 thi-1 relA1 ∆(lac-proAB) 
TOP10  F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG 
TOP10/P3  F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆ {P3: KanR AmpR (am) TetR (am)} 
TOP10F´  F´{lacIq Tn10(TetR)} mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG 

Compatible Restriction Ends

Protruding End Unambiguous Ambiguous
5´-AATT  Apo I EcoR I Mun I Tsp 509 I   
5´-AGCT  Hind III   
5´-CATG  BspLU11 I Nco I Rca I  Afl III, BsaJ I,Dsa I, Sty I 
5´-CCGG  Cfr 10 I, Kpn2 I, PinA I, SgrA I, Xma I  Ava I, BsaJ I 
5´-CG  Aci I, BsaH I, Cla I, HinP1 I , Hpa II , Mae II, Msp I, Nar I, Nsp V, Psp1406 I, Taq I  Acc I 
5´-CGCG  Asc I, Bss H II, Mlu I  Afl III, BsaJ I, Dsa I 
5´-CTAG  Avr II, Nhe I, Spe I, Xba I  BsaJ I, Sty I 
5´-GATC  BamH I, Bcl I, Bgl II, Bsp1407 I, Bst Y I, Mbo I, Nde II, Sau 3A I   
5´-GGCC  Eae I, Not I, Xma III   
5´-GTAC  Asp718 I, Sun I  Ban I 
5´-GTCAC    Tsp 45 I 
5´-GTGAC    Tsp 45 I 
5´-TA  Mae, Mse I, Nde I, Vsp I   
5´-TCGA  Sal I, Xho I  Ava I 
5´-TGCA  Alw 44 I  Sfc I 
5´-TTAA  Afl II   
ACGT-3´  Aat II   
AGCT-3´  Sst I  Alw21 I, Ban II 
AT-3´  Pac I, Pvu I   
ATC-3´  Sgf I   
CATG-3´  Nla III, Nsp I, Sph I   
CG-3´  Hha I   
GC-3´  Sst II   
GCGC-3´  Bbe I, Hae II   
GGCC-3´  Apa I, Fse I  Ban II, Sdu I 
GTAC-3´  Kpn I   
TGCA-3´  Nsi I, Pst I, Sse8387 I  Alw 21, I Sdu I 

Two Digest

To Perform a Double Digest To Perform a Sequential Digest
Choose the REact® buffer that has 100% activity for each enzyme. If no single buffer fulfills these requirements, then choose a buffer that ensures the highest activity possible without causing nonspecific cleavage.  Perform the reaction with the restriction endonuclease that requires the lowest salt conditions first. If the enzyme can be heat inactivated, stop the first reaction by heating for 10 minutes at 65°C. Then adjust the salt concentration with minimal increase in volume to approximate the optimal conditions for the second enzyme. Add the second enzyme and perform the reaction. Note: If either enzyme is affected by glycerol, make certain that the glycerol concentration does not exceed 5% when both enzymes are present.