Invivofectamine® 2.0 Reagent FAQ's
| In vivo experiments are by nature complex and intricate. We recognize that protocols, however well defined, cannot cover all contingencies. To help ensure that your experiments are successful, we have put together a set of frequently asked questions to help guide your work. We also recommend that you take advantage of our in-house experts to design your experiments, answer your questions, and where needed, help troubleshoot your experiments. |
siRNA purity and potency
Q: What level of siRNA purity do you recommend?
A: We recommend that your siRNA is of the highest quality available. In vivo purity siRNA from Invitrogen or highly purified and desalted siRNA is required for good results. Failures in synthesis, excess salts, free nucleotides, and improperly purified siRNA may result in poor performance in vivo.
Q: Do I need to concentrate my siRNA before complexing with Invivofectamine® 2.0 Reagent?
A: Your siRNA must be at least 3 mg/mL in RNase/DNase-free water before complexing. siRNA stock concentrations lower than 3 mg/mL will result in low encapsulation efficiencies. We also recommend that you confirm the siRNA concentration before complexing with Invivofectamine® 2.0 Reagent to verify the correct concentration. After resuspension in RNase/DNase-free water, measure the OD at 260 nm of several serial dilutions of the stock and calculate the concentration. For more information on how to calculate concentration based on OD measurements, please visit www.lifetech.com/invivofectamine, then follow the link to the in vivo RNAi protocols page.
Q: Do I need to test my siRNA in vitro before using it in vivo?
A: YES! We recommend that you test at least 3 different siRNA duplexes in vitro at several different concentrations and use the siRNA duplex with the highest potency for your in vivo experiments. When moving from in vitro to in vivo experiments, it is also important to double check the species specificity of the duplex.
Experimental planning
Q: Should I use any particular strain of mouse in my experiments?
A: We recommend the use of inbred strains for in vivo experiments, because these strains provide a uniform experimental background in which to determine gene knockdown and downstream effects. In addition, we recommend purchasing animals that are in good health from a qualified vendor. Starting with sick or lethargic mice is likely to result in problems during the experiment
Q: Do I need to weigh my mouse/animal to determine dosing, or can I use the standard 200 µL of complexed material for systemic intravenous or intraperitoneal injections?
A: To ensure the best results and minimal toxicity, it is very important to determine the weight of each animal to provide the correct dose and to maintain uniform dosing of multiple animals. The recommended dose for mice is between 5–7 mg/kg (IP or IV), depending on the potency of your siRNA.
Q: How many mice should I inject per treatment?
A: We recommend injecting 3–5 mice per treatment to assess the reproducibility of the results within an experiment.
Q: What controls should I use?
A: Both positive and negative controls are recommended when performing any siRNA experiment. We typically use Ambion® in vivo siRNA against Factor VII (see table below) with Invivofectamine® 2.0 Reagent, as a positive control for experiments (qRT-PCR TaqMan® primers are listed in the table below). It is also good practice to use PBS solution as a negative control.
Q: Can I modify the encapsulation protocol to fit my schedule?
A: The protocol is robust but specific. Protocol modifications will likely result in less than optimal performance.
Q: How important is sterile technique?
A: Sterile technique is vital to successful completion of in vivo experiments. All materials need to be sterile before injecting the complexed siRNA into animals.
Q: What rate should I use to inject complexed material for a systemic injection?
A: Invivofectamine® 2.0 Reagent is designed to be delivered slowly and evenly; a 200-µL injection should take between 10 to 20 seconds.
Q: Can I anesthetize my mice for the tail vein injection?
A: We do not recommend anesthetization of the mice before injection, because it may affect the performance of the product
Q: I put my Invivofectamine® 2.0 Reagent in the refrigerator, and now I see a small precipitate. Can I still use it?
A: This is not unusual, just vortex gently to resuspend the pellet, and use as recommended.
Q: I don’t have any dialysis membranes. Can I stop after the complex formation step until I receive my dialysis membranes?
A: No, it is not recommended to stop at that step of the dialysis protocol. However, you can dilute the complex with 15 volumes of PBS, store the diluted complex at 4°C, and proceed with the diafiltration protocol using Amicon® columns (Diafiltration protocol) instead.
Q: For the dialysis protocol, can I use something other than Spectra/Por Float-A-Lyzer® G2 8-10 kD (Spectrum Medical Laboratories, Cat. no. G235031)?
A: Other dialysis systems (e.g., Slide-A-Lyzer™ system) can be used, as long as the MW cutoff is 8-10 kDa. However, at the end of the dialysis, you may observe a larger volume increase compared to when the Spectra/Por Float-A-Lyzer® G2 8-10 kD is used.
Q: For the diafiltration protocol, can I use something other than Amicon® columns?
A: TFF or other diafiltration systems can be used, as long as the MW cutoff is 50 kDa.
Q: In the diafiltration protocol, it is taking a long time to concentrate the samples using Amicon® columns. Is this normal?
A: Check for column overload. (We do not recommend using more than 15 to 30 mL per column). Solution: Split the sample over 2 columns and re-spin.
Q: How do I isolate RNA from liver or other organs?
A: Isolating high-quality RNA is critical to the overall success of in vivo experiments. Please visit www.invitrogen.com/invivofectamine, then follow the link to the in vivo RNAi protocols page.
Q: Do you have any suggestions for genes to use for normalizing my qPCR analysis?
A: We recommend using housekeeping genes for normalization. A list of genes, primer sequences, and siRNA/Stealth RNAi™ sequences can be found at www.invitrogen.com/invivofectamine (follow the link to the in vivo RNAi protocols page). The expression levels of housekeeping genes can vary depending on the experimental conditions and/or tissue type. We have obtained the most consistent results by normalizing target gene expression to HMBS and GAPDH.
Stealth RNAi™ siRNA controls
| Stealth™RNAi™ Sequences | Species Specificity | Sequence | |
| Stealth RNAi™ Factor VII | Mouse, Rat | Sense | GAAUGAGCAGCUGAUCUGUGCAAAU |
| Antisense | AUUUGCACAGAUCAGCUGCUCAUUC | ||
| Stealth RNAi™ APOB | Mouse, Rat | Sense | ACCAUUUGAGAUUACUGCAUCCACA |
| Antisense | UGCUCUUUCCUCCUGUGCCAUCUCC | ||
| Stealth RNAi™ GADPH | Mouse, Rat | Sense | UCACUCAAGAUUGUCAGCAAUGCAU |
| Antisense | AUGCAUUGCUGACAAUCUUGAGUGA | ||
| Stealth RNAi™ PPIB | Human, Mouse, Rat | Sense | GGAGAUGGCACAGGAGGAAAGAGCA |
| Antisense | UGCUCUUUCCUCCUGUGCCAUCUCC |
Ambion® In Vivo siRNA controls
| Cat# | Name | Scale |
| 4457287 | Ambion® In Vivo Negative Control #1 siRNA, 5 nmol | 5 nmol |
| 4457288 | Ambion® In Vivo GAPDH Positive Control siRNA, 5 nmol | 5 nmol |
| 4459405 | Ambion® In Vivo Negative Control #1 siRNA, HPLC In Vivo Ready, 50 nmol | 50 nmol |
| 4459407 | Ambion® In Vivo GAPDH Positive Control siRNA, HPLC In Vivo Ready, 50 nmol | 50 nmol |
| 4459408 | Ambion® In Vivo Factor VII Positive Control siRNA, HPLC In Vivo Ready, 50 nmol | 50 nmol |
| 4457289 | Ambion® In Vivo Negative Control #1 siRNA, HPLC In Vivo Ready, 250 nmol | 250 nmol |
| 4457291 | Ambion® In Vivo GAPDH Positive Control siRNA, HPLC In Vivo Ready, 250 nmol | 250 nmol |
| 4457292 | Ambion® In Vivo Factor VII Positive Control siRNA, HPLC In Vivo Ready, 250 nmol | 250 nmol |
TaqMan® Assays
| HMBS | Mouse | Mm00660260_m1 | |
| Mm01143545_m1 | |||
| APOB | Mouse | Mm01545156_m1 | |
| Mm01545159_m1 | |||
| Factor VII | Mouse | Mm00487333_m1 | |
| Mm00487329_m1 | |||
| GAPDH | Mouse | Mm99999915_g1 | |
| Mm03302249_g1 | |||
| PPIB | Mouse | Mm00478295_m1 | |