Page Content
miRNA Isolation
When using the NCode™ Amplification Kit, at least 50 ng of total RNA is needed to run one slide in a single color. If the NCode™ Amplification Kit is not used, then approximately 250ng - 5μg of total RNA is needed to run one slide in a single color or to run two slides with different colors (dye-swap).
NOTE: If less than 250 ng of starting sample is available, then we recommend the using the NCode™ Amplification Kit. For starting sample less than 500 ng, amplification is not required; however, it should be considered where there is interest in investigating miRNAs that are expressed a low levels and replicates are desired.
For the original NCode™ miRNA Labeling sytem, 10 µg of total RNA (or equivalent cells or tissue) was recommended and yields approximately 200 -600 ng of small RNA, depending on the sample.
The protocol for the NCode™ Rapid miRNA labeling system indicates total RNA should be used as starting material. Will I obtain better results if miRNA is used?
We recommend using total RNA as starting material. We have seen better sensitivity with total RNA as opposed to enriched miRNA, this may be due to some material loss that can be seen with column purification steps.
How do I recover the large RNA fraction from the Purelink™ miRNA Isolation Kit after isolating the small RNAs?
In most cases, total RNA should be used with the NCode™ Rapid miRNA System. Contact Invitrogen Technical Support and a representative will guide you through the protocol.
Does the isolated RNA fraction contain a mixed population of mature and precursor miRNA ?
The isolated small RNA fraction may contain precursor miRNAs; circumstantial evidence, however, suggests that this may not be the case. The following observations support this:
A. Existing papers agree that miRNA precursors turn over very quickly. Even if they were labeled, the signal contributed would be negligible.
B. The reverse sequences of several miRNAs printed on the array do not light up, as is expected if only the mature miRNA is labeled.
C. We have designed primers for qRT-PCR in the stem loop region of the precursor miRNA and seen Cts at least 5-6 behind that of the mature miRNA.
Which protocol should I use to enrich for miRNA?
If you are enriching for LMW RNA using the PureLink™ miRNA Isolation Kit, we recommend enriching from total RNA as opposed to cells or tissue. The PureLink™ miRNA Isolation Kit manual includes a protocol for large sample amounts that starts with the isolation of total RNA using TRIzol® Reagent. We recommend using this protocol in NCode™ labeling applications, even if you are not starting with large sample amounts.
What does Invitrogen suggest using to isolate RNA from blood or serum samples?
Our NCode™ Rapid miRNA Labeling System does not require miRNA enrichment, so in general we recommend TRIzol® for isolation of total RNA as small RNAs are retained during purification. There is a modified TRIzol® reagent called TRIzol® LS that is designed for liquid samples.
miRNA Labeling
We recommend normalizing the samples at the tissue level or the total RNA level (gram for gram), prior to miRNA enrichment. If one of the samples has a lot of miRNA or degraded RNA, then the results may be altered if normalized at the miRNA level.
Is it necessary to do a dye-swap with Invitrogen’s labeling technology?
We recommend running each sample with both dyes. This reduces any dye bias when analyzing your samples.
How many samples/arrays per day can be processed? How many people do I need?
The number of samples that can be processed in a single day depends on the equipment and scientists available. Typically, one person can process 48 microarrays per week, including sample preparation time and analysis.
Does Invitrogen supply products to support plant based miRNA profiling?
Not at this time. Probes for plant miRNAs are not present on the current NCode™ miRNA microarrays.
Do you have to use RNAase free reagents with the NCode™ miRNA labeling kits?
It would be safest to use RNAse free reagents, preferably those provided with the kit.
Are the NCode™ miRNA arrays designed to do single labeling (two cell populations are hybridized separately and then superimposed to identify differences) or dual labeling (miRNA from two cell populations are hybridized to the plate at the same time)?
The arrays can be used for dual labeling by attaching different flurophors (Alexa Fluor® 3 or 5 ) to each of the two samples populations. Ncode™ Profiler can hen be used for anlyzing the data.
If single color labeling is utilized, Ncode™ Profiler does not currently support this. Future versions of the software may include the ability to analyze single-color data. See the related FAQ under Data Analysis.
What are good stopping points in the NCode™ miRNA labeling kits?
The following stop points seem to work fine without compromising the overall protocol:
- Tagged miRNA (post PAP reaction and ligated to the capture sequence) can be stored at -20C.
- For the original NCode™ labeling system only: Following the first hybridization of tagged miRNA and washing, the slide can be stored for up to 48h at room temperature after drying.
Do the NCode™ miRNA labeling kits exhibit dye bias (green dye labels better than the red dye)?
Under the same experimental conditions, the two dyes should be labeled to the same extent with no obvious bias. However, the red dye (Alexa 5) is slightly more susceptible to photobleaching compared to the green dye (Alexa 3). Due care should be taken to protect the dyes from exposure to light. It is advisable to do a pre-scan and normalize the PMT (photomultiplier tube) gain settings to get similar signal intensities from the red and green channel. This would reduce any effect of dye bias. See related FAQ on dye swap experiments.
Microarray Probes and Controls
What types of scanners are compatible with the NCode™ Microarrays?
The NCode™ miRNA Microarrays may be scanned using a standard digital microarray scanner with a resolution of at least 16 bits/pixel. Please refer to Microarray Scanners for more information.
What exactly is needed to scan the array?
-A standard digital microarray scanner. We recommend a scanner with a bit depth of at least 16 bits/pixel.
The GenePix® 400B (Molecular Devices) has been tested with the NCode™ microarrays, and includes GenePix® software for analyzing the scanned image.
-Microarray acquisition and analysis software, such as the GenePix® Pro (Molecular Devices) or ScanArrays® Express (PerkinElmer, Inc.)
What are the overall dimensions and X & Y spot coordinates for the array?
The NCode™ Multi-Species miRNA Microarray V2 has the following specifications. Click to view details of the array layout.
- Substrate: Corning® Epoxide –Coated Glass Slides
- Print method: Contact printed using microquill pins
- Total subarrays per slide: 3
- Subarray layout: 8 blocks (4 rows × 2 columns)
- Block layout: 192 spots (12 rows × 16 columns)
- Block dimensions: 4 mm × 3 mm
- Average spot diameter: 120 μm
- Spot center-to-center spacing: 265 μm
- Probes: Unmodified oligonucleotides, 34–44 bases long
Can precursor miRNAs be detected on the array?
Precursor miRNAs have a very rapid turnover in the cell and will most likely not be detected by the NCode™ miRNA Microarrays.
What is the exact nature of the controls for the NCode™ Multi-Species miRNA Microarray ?
Dye normalization control: Alexa Fluor® Dye Control Probes are printed in a range of concentrations on the V2 array to allow for normalization of differences in fluorescent signal intensities between the two capture reagents. Refer to the NCode™ Multi-Species miRNA Microarray Kit V2 User Manual for more detail. The NCode™ Human miRNA Microarray also cotains controls for dye normalization.
For the NCode™ Rapid miRNA Labeling System, the NCode™ Dye Normalization Control is a synthetic oligonucleotide that is similar to the oligo(dT) bridge in the ligation mixes. However, instead of bases complementary to the tailed RNA, it includes bases complementary to the Alexa Fluor® Dye Control Probes printed on the NCode™ Multi-Species miRNA Microarray. It is designed to bind the dye-labeled DNA polymers in the ligation mixes to the Dye Control Probes, to normalize for differences in fluorescent signal intensities between the two Alexa Fluor® dyes.
Positive Control:The NCode™ Multi-Species miRNA Microarray Control V2 is a synthetic 22-nucleotide miRNA sequence that has been designed as a positive control for use with the NCode™ Multi-Species miRNA Microarray system and is spotted throughout the array. Use this control in conjunction with the NCode™ miRNA Labeling System and NCode™ microarrays and probe sets to assess the efficiency of array labeling and hybridization.
What is the concentration of the NCode™ Multi-Species miRNA Microarray Control V2 ?
NCode™ Multi-Species miRNA Microarray Control V2 is provided at a concentration of 2 pmol/μL in a volume of 10 μL.
Are the control probes on the NCode™ Multi-Species miRNA Microarray V2 spotted in the same concentration?
The NCode™ Control probe is spotted at the same concentration throughout the array; however, the dye normalization control probes are printed in a range of concentrations.
What are the probes used to design the NCode multi-species miRNA microarray V2?
The NCode™ Multi-Species miRNA Microarray V2 consists of oligonucleotides complementary to known miRNA sequences for human, mouse, rat, D. melanogaster, C. elegans, and Zebrafish. These species-specific, unmodified oligonucleotides are designed from the miRNA sequences in the Sanger miRBase Sequence Database, Release 9.0. The array also includes probes for some small nucleolar RNAs. Each miRNA probe is synthesized as a tandem repeat and is spotted in triplicate. The microarray is also spotted with control probes for a unique miRNA sequence that has been designed not to cross react with endogenous miRNAs. In addition, there is a dye control printed in a range of concentrations from high to low, to allow for dye normalization durning scanning.
The NCode™ Human miRNA Microarray V3 contains optimized probes to the known mature miRNAs in the miRBase Sequence Database, RElease 10.0 for human. In addition, there are probes to 373 novel human miRNAs discovered through deep sequencing, and biologically validated by array/qRT-PCR. There are also probes for some small nucleolar RNAs, in addition to the mismatch and dye normalization controls also present on the V2 array.
What is the citation through which the NCode miRNA probe design was introduced?
Goff, L. A., Yang, M., Bowers, J., Getts, R. C., Padgett, R. W., and Hart, R. P. Rational Probe Optimization and Enhanced Detection Strategy for MicroRNAs Using Microarrays. RNA Biology, 2005; 2(3) 93-100.
Why are the probes in the NCode miRNA probe set 40-44 bases long while the mature miRNAs are only 20-22 bases?
The probe set oligos are mature miRNAs synthesized as tandem repeats, so the same sequence is present in two adjacent copies (total length 40-44 bases). This helps in signal enhancement.
What is the dynamic range of the NCode™ Multi-Species miRNA Microarray?
When starting with 10 ug of total RNA for miRNA enrichment for the original labeling system,, we were able to detect down to 0.3 fmol (corresponding to hundreds of copies) with static hybridization. Incubation in the MAUI hybridization station further improves the detection sensitivity. We have not run into a case of saturating the detectors due to having too high a concentration of miRNA.
When starting with 500 ng -5 ug total RNA for the NCode Rapid miRNA labeling system, we were able to detect attamolar levels of miRNA corresponding to 2-10 copies per cell with the the MAUI hybridization station. Lower starting amounts of total RNA may be used (down to 100ng has been tested) but keep in mind that lower expressed miRNAs may be lost with reduction of starting material amount.
Does the NCode Multi-Species miRNA Microarray have to be blocked before hybridization?
Unprinted areas of the microarray are fully blocked to reduce background fluorescence. No additional blocking steps are necessary.
Can the NCode microarray slides be left in wash solution 3 prior to centrifugation?
Yes, as long as the slides are not exposed directly to air.
What is recommendated for drying the arrays?
With the NCode™ Rapid miRNA labeling system, centrifugation or compressed air may be used for drying, though centrifugation is recommended.
With the original labeling system, it is critical to dry slides by centrifugation rather than with compressed air. In addition, slides should be immediately placed into centrifuge and dried after washing as to prevent any air-drying. If slides need to be transported to the centrifuge, keep them in the wash buffer until they are placed in the centrifuge. Allowing to air dry or drying with compressed air will lead to streaking and high background. We recommend using a centrifuge that can spin at the recommended 600 X g and contains a microtiter plate rotor adapter for the slide rack. The wash buffer tends to give a green background signal if allowed to air dry.
How do I reduce Cy5 or Alexa 647 fading?
Cy5 and Alexa 647 dye performance may be affected by a variety of factors that are particularly prevalent during the summer months. Exposure of these dye solutions and the hybridized arrays to light and to oxidative environments may cause rapid fading of these dies, regardless of the labeling system used. Limiting or controlling the exposure of the arrays to these environments has been shown to significantly reduce fading. The following recommendations will help reduce fading:
- Always keep solutions and arrays containing Cy5 away from light, including normal fluorescent lighting.
- Do not use plastic coverslips or a hybridization chamber in which plastic parts come in contact with your hybridization mixes. Do not use amber tubes to aliquot the dyes-the coating tends to react with the dye.
- Be sure to follow the protocol for proper preparation (thawing, mixing, and heating) of all capture reagents before each use.
What is the recommended PMT and laser intensity setting for scanning the NCode™ miRNA Microarray?
Most commercially available scanners are compatible with the NCode arrays. The intensity of the signal will vary from scanner to scanner because of differences between the hardware (lasers, filters, etc.) used by each manufacturer. Consult the user manual of your specific scanner for recommended laser and PMT settings prior to scanning.
Are the NCode™ GAL files lot specific? Can the same GAL file be used for different lots?
No, the NCode™ Multi-Species miRNA Microarray V2 and the NCode™ Human miRNA Microarray V3 GAL files are not lot specific. The GAL files were lot specific for an earlier version (V1) of the NCode™ Multi-Species miRNA Microarray.
What exactly are GAL files?
The GAL (GenePix® Array List) files for the array are tab delimited text files that contain the positions, names and probe ID's of the probes on the NCode™ miRNA microarrays in tabular format. For the MultiSpecies V2 array, GAL files are available for individual species on the array, or a single GAL file is available for the entire array. Most major microarray software applications, including GenePix® Pro and Scan Array®, can combine the information from the GAL file with the data from the scanned array to generate a results file with all of the data for the experiment.
Note: If your software does not accept files in GAL format, open the file in a spreadsheet program like Microsoft® Excel and reformat the information in a compatible configuration, or manually correlate information with your spot intensity data. Consult your cmicroarray analysis software for details.
What are the differences between the NCode™ Multi-species miRNA Microarray Kit V2 and the earlier NCode™ Multi-Species miRNA Microarray V1?
There are primarily three differences:
- The earlier V1 arrays had probes to all miRNAs listed in version 7.0 of the Sanger miRBase database and included human predicted miRNAs. The NCode ™ Multi-species miRNA Microarray Kit V2 is based on version 9.0, and it does not contain any human predicted miRNAs.
- The NCode™ Multi-species miRNA microarray V1 was laid out as two duplicate subarrays whereas the V2 is laid out as three replicate subarrays.
- The NCode™ Multi-species miRNA Microarray Kit V2 includes Alexa Fluor® Dye Control probes for easy normalization of signal intensities during scanning (V1 did not have this feature).
What hybridization method is best?
Static hybridization is fine- but not as sensitive as a dynamic mixing system. We use the MAUI hybridization system and this gives approximatly 10x better sensitivity than the static method. The Agilent or Miltenyi chambers can be used as well.
What protocol is used for the MAUI hybridization system?
We use the standard labeling protocol and hyb buffer recommended in our labeling kit manual. We use SL mixers and load a 47uL volume. We mix in mode A.
Is a specific hybridization oven recommended?
We prefer using an oven over a water bath for static hybridizations because teh water bath can be quite dirty. However, both should wok fine. In general, any hybridization oven is okay as long as it can be made light proof.
Are there other slides and cover slips that are compatible with the system other than the Corning chambers and the LifterSlips recommended in the manual?
Yes, Fisher sells coverslips (LifterSlip Cover slips for Microarry Slides) that will work.
There is also a hyb chamber from Monterey Industries that we have been told works fine.
What can cause grid to grid variability on the array?
Ensure that there are no air bubbles trapped under the coverslip. Also ensure handling of the dendrimers is as specified in the manual. if the dendrimers are aggregate it can lead to signal variability. One other common contributor to variability is with the coverslips used. We see less variability using the 25x60 slips. If too narrow or short the array does not get uniform coverage . The boundary of the lifter slip needs to be as far from the array as possible.
Larger wash tubes are preferred. Our wash tubs hold around 500ml of wash buffer.
Overall, variability is usually due to uneven hyb across the surface of the array. This is much more pronounced when static hybs are done compared to when mixing devices are used.
Data Analysis
The loop design model allows for each sample to be compared to each other sample. Having the samples hybridized in another manner can the limit the amount of comparisons that can be done with statistical significance. For more information on the loop design for NCode™ miRNA Microarray experiments, see Experimental Planning.
What software is recommended for analysis of the NCode™ miRNA Microarray data?
Any analysis software associated with the scanner should be fine. For more information, see Experimental Planning. Invitrogen has now released a free software program called NCode™ Profiler available for download.
If I prefer to use single color labeling, how should I analyze my data?
Currently, NCode™ Profiler does not perform single color analysis, but future versions of the software may support this. Below are the suggestions for single color analysis:
1. GeneSpring can be used for this type of analsis. There is also freeware at http://www.tm4.org/midas.html that can be used to normalize the data. We highly recommend technical replicates on separate chips if possible.
2. We recommend first normalizing values globally across a chip to the median value and secondly normalizing per gene across chips.
3. You can then use these normalized values to assess statistical signifcance of fold change, make heat maps and Venn diagrams.
qPCR Analysis
Researchers studying miRNA expression levels are usually looking for comparative quantification instead of absolute quantification. The purpose for running a standard curve includes:
- To validate the efficiency of the miRNA primer set
- To validate the qPCR conditions
- To check the R2 value
- To identify the dynamic range of the assay (or what is the most and least amount of template that can be effectively detected under certain conditions)
To accomplish this, researchers perform a dilution series of total RNA, ideally from the same sample that their unknown miRNA targets will be coming from. Start from a very high concentration and dilute to very low concentration knowing that points on the standard curve can always be removed if efficiency is affected. Once the template range results are within 90-110% efficiency, any total RNA amount that sits on the standard curve for the actual experimental sample assays can be used. Separate standard curves must be generated for the miRNA of interest and the normalizer RNA of interest.
What type of RNA internal standards are there for quantitative determination of miRNA?
The most common normalizer options for miRNA quantitation have been U6 snRNA and 5S rRNA. Of course with any qPCR reaction, their consistent expression must be validated beforehand. We typically use traditional housekeeping genes such as GAPDH or B2M for normalization, once we have confirmed expression is similar across the samples being studied. miRNAs or snRNAs can be used but only if it is comfirmed that expression does not change across all of the samples. There is not one universal miRNA or snRNA that can be used in all cases. Sequences we have sued for housekeeping genes are in the table below.
| Gene | Species | Primer Name | Sequences |
|---|---|---|---|
| 18S rRNA | Hs/Mm | 18S FW 18S RV | TTGGAGGGCAAGTCTGGTG CCGCTCCCAAGATCCAACTA |
| Actin | Homo sapiens | hActB FW hActB RV | AGGCCAACCGCGAGAAGATG GCCAGAGGCGTACAGGGATA |
| ATPSase | Homo sapiens | hATPSase FW hATPSase RV | TGTTGAGCAGGAAATTCTGGG CAGTCTTGCCAACTCCAGCAC |
| B2M | Homo sapiens | hB2M FW hB2M RV | CCGTGGCCTTAGCTGTGCTC TCCATTCTCTGCTGGATGACG |
| GAPDH | Homo sapiens | hGAPDH FW hGAPDH RV | CGCTGAGTACGTCGTGGAGTC GCAGGAGGCATTGCTGATGA |
| GUS | Homo sapiens | hGUS FW hGUS RV | GCGGTCGTGATGTGGTCTGTG GGGTCCAAGGATTTGGTGTGA |
Does the NCode SYBR Green miRNA qPCR kit require isolation of miRNA for detection and quantification of miRNA ?
No, miRNA isolation is not required. These kits have been optimized for the detection of miRNA from 10 ng to 2.5 μg of total RNA using a miRNA specific forward primer and an universal qPCR primer.
What is the sequence of the universal primer contained in the NCode™ miRNA qPCR kit?
The sequence of the universal primer is proprietary, and is not disclosed.
How should I design the miRNA qRT-PCR primer to be used with the NCode™ system?
Invitrogen has already designed primer sequences that you may use for each miRNA on our arrays. These can be found within the NCode™ database.
The Tm of the primers were calculated using nearest-neighbor approximation based on the following reference:
John SantaLucia, Jr. Hatim T. Allawi, and P. Ananda Seneviratne. Improved Nearest-Neighbor Parameters for Predicting DNA Duplex Stability. Biochemistry 1996, 35:3555-62
If you are designing a primer for a unique or novel small RNA, please consider the information below.
The optimal Tm range is 58-65. For sequences with calculated Tm less than 58, either "A"s may be added to increase Tm, or modified bases could be substituted. No more than 6 "A"s should be added to any one sequence. The maximum primer length designed was 30 nucleotides. For sequences with calculated Tm greater than 65, bases were trucated from the sequence and the resulting primer should be at least an 18mer match to the target. In most cases, bases can be removed from the 3' end but care should be taken to analyze the best position to truncate when there are closely related family members that are being quantitated independently.
What are the advantages of the NCode™ qRT-PCR system?
The NCode™ First strand cDNA synthesis system allows for generation of a "universal" cDNA that is generated from all RNA species present in the input samples. This is what allows housekeeping genes or alternate normalizers to be used for amplification within the same sample. This cDNA can be archived, or stored for use at a later time for analysis of other small RNAs. This can be essential when samples are precious and it is not a possibility with miRNA specific qRT-PCR assays.
Since standard custom oligos are used for the qPCR step, this system is generally less costly than alternate methods. We also provide general design guidelines for primers, which allows for design and detection of novel miRNAs or other small RNAs for which there is no validated miRNA specific assay available.
How should I design the miRNA qRT-PCR primer to be used with the NCode™ system?
Invitrogen has already designed primer sequences that you may use for each miRNA on our arrays. These can be found within the NCode™ database. The Tm of the primers was calculated using nearest-neighbor approximation based on the following reference:
John SantaLucia, Jr. Hatim T. Allawi, and P. Ananda Seneviratne. Improved Nearest-Neighbor Parameters for Predicting DNA Duplex Stability. Biochemistry 1996, 35:3555-62.
If you are designing a primer for a unique or novel small RNA, please consider the information below:
The optimal Tm range is 58–64 °C. For sequences with calculated Tm values less than 58 °C, either "A"s may be added to increase Tm, or modified bases could be substituted. No more than 6 "A"s should be added to any one sequence. If an increase in Tm is still needed, GC residues can be added to the 5’ end. The maximum primer length designed was 30 nucleotides. For sequences with calculated Tm greater than 64 °C, bases were truncated from the 5’ end and the resulting primer should be at least an 18-mer match to the target. In most cases, bases can be removed from the 3' end but care should be taken to analyze the best position to truncate when there are closely related family members that are being quantitated independently.
What are the differences between the original NCode™ miRNA first-strand synthesis and qRTPCR kits and the newer versions incorporating the SuperScript® VILO™ cDNA Synthesis Kit and EXPRESS SYBR® GreenER™ dye?
There are quite a few changes in the newer kits as compared to the previous version. First, the workflow has been streamlined and we have carefully optimized a combined polyadenylation and reverse transcription step. Second, the universal RT primer has been redesigned. This means a different universal qPCR primer is needed for cDNA generated with the newer formulation than with the previous version. Lastly, we have incorporated the latest Invitrogen enzymes into the mixes: the SuperScript® VILO™ cDNA Synthesis Kit, which provides the most reliable first-strand synthesis and higher cDNA yields, and the newest SYBR® GreenER™ dye, now specifically tailored to deliver superior results on high-throughput, fast-cycling instruments.
NCode™ miRNA Analysis Services
Total RNA samples should be shipped on dry ice. We recommend to quality controlling the total RNA sample before shipment.
For profiling services, how much total RNA is needed?
We prefer 5 ug of total RNA per sample to be submitted for services. This allows for replicates, as well as sufficient material in case any optimization of the process is needed. We can also work with smaller starting amounts if required, please discuss this with our custom service team.
Can I review sample data from the miRNA profiling service?
All of the experiments we perform and the results we generate are confidential. The results of Invitrogen’s analysis service include test statistic, P value and Fold Change, along with rankings of the miRNA expression for each sample and a file of normalized log2 values for cluster analysis.
NCode⢠Human and Mouse Non-coding RNA Microarrays
Which method should I use to assess the quality of my total RNA?
| Instrument | Metric |
|---|---|
| Agilent Technologies 2100 Bioanalyzer | RNA Integrity Number (RIN) > 8 |
| Thermo Scientific NanoDropTM Spectrophotometer | A260/A280 ratio between 1.8 and 2.0 |
| E-Gel Electrophoresis System, or equivalent | Strong rRNA bands w/no degradation density: 28S > 18S > 5.8s |
How much starting material is needed for cRNA target synthesis using the Superscript Indirect RNA Amplification System?
We recommend using 0.5 µg to 1.0 µg of starting material (total RNA) per reaction.
How much starting material is needed if preparing cDNA targets with the SuperScript® Plus Indirect (or Direct) cDNA Labeling System with Alexa Fluor Dyes?
We recommend using at least 5.0 µg of starting material (total RNA) per reaction.
How do I prepare the Agilent RNA Spike-In Mix?
Single color: One Color RNA Spike-in Kit Protocol (5188-5977)
Dual color: Two Color RNA Spike-in Kit Protocol (5188-5928)
What volume of the diluted RNA Spike-In Mix do I add to each reaction?
| Component | | Vol (µl)/reaction |
|---|---|---|
| total RNA + dH2O | 0.5-1.0 µg | 4.0 |
| RNA Spike-In Mix | 3rd dilution | 5.0 |
| T7 oliog-dT primer | | 1.0 |
| | | Total: 10.0 |
Why is DTT used in the first strand synthesis reaction?
This is required by the enzyme for optimal efficiency.
Why is E. coli DNA ligase used in during second strand synthesis?
After the first strand is synthesized, DNA Pol I will use the fragmented RNA template as primer for the second strand replacement synthesis. The E. coli DNA Ligase is used to fill any gaps or nicks caused by RNase H.
How long can ds cDNA be stored at -20°C?
Indefinitely
Is the DNase I treatment optional?
Yes, it is optional.
What is the minimum/maximum time required for the in vitro transcription reaction?
Recommended time is between 4 and 14 hrs. 4-6hrs should produce enough cRNA for most microarray applications. Longer incubation times will produce greater yield.
Should I use DEPC-treated water or RNase/DNase-Free water?
Both are acceptable.
What is the expected cRNA yield when starting from 500ng of total RNA?
The expected yield from 500ng of HeLa control RNA is >20 µg
Are there any places within the protocol to stop if needed?
The sample may be stored after second strand cDNA synthesis is complete.
Should I use single or dual color labeling?
Both single color and dual color labeling are supported. Experiment design, sample size, data analysis model, and processing capability are several factors that should be carefully considered when determining with which labeling method is best.
Single color labeling will offer the greatest versatility and ease of downstream analysis. Use either Alexa Fluor 555 or Cy3 with this approach. Recommended
Dual color is applicable when measuring the relative expression levels between 2 samples or conditions (e.g. cell line A vs. cell line B). Typically used with a reference or loop model design. Dye swaps are usually included, but are optional .
How many biological replicates do I need for each condition? Technical replicates?
We highly recommend using a minimum of 3 biological replicates per condition in your experiment.
Can I store my labeled cRNA overnight before hybridizing to the array?
You may store the labeled cRNA in the dark at -80°C.
What size cRNA fragments should I expect to see after the fragmentation step?
The typical size range for fragmented cRNA is between 50 and 200nt.
Which target preparation method do you recommend?
Generating labeled cRNA targets via the Superscript Indirect RNA Amplification System (or equivalent)
How much of the labeled cRNA target is used in the hybridization reaction? Answered in FAQ
Single color: 1.5ug per sample
Dual color: 1.5ug per dye
What result can I expect if I use slightly degraded RNA?
The recommended RNA amplification protocol uses a T7-poly(dT) primer for first strand cDNA synthesis. This intermediate template is then amplified into cRNA. Using degraded RNA will result in substantially shorter cRNA products, which increases the 3’ end bias. The resulting data may not be representative of the sample’s true expression levels.
How do I use the files contained on the CD?
The included insert contains more information on how to use the files.
Which microarray scanners are compatible?
- Agilent Technologies DNA Microarray Scanner model #G2565BA
- Agilent Technologies DNA Microarray Scanner model #G2565CA
- Axon GenePix® 4400A
- Axon GenePix® 4300A
- Axon GenePix® 4200A/AL
- Axon GenePix® 4000B
- Axon GenePix® 4100A
- ArrayIt InnoScan 900 Series
- PerkinElmer® ScanArray®
- PerkinElmer® ProScanArray®
Which versions of Agilent’s Feature Extraction software are compatible?
Files have been tested using Feature Extraction Software Version 9.5, but should also work with FE Version 8.5 through 10.1.1
Is the NCode miRNA Rapid Labeling System compatible with the non-coding array?
No, the NCode miRNA Rapid Labeling System is NOT compatible with the Non-coding RNA array.
Custom Services
Need help with your miRNA research? Contact us for a consultation and quote today.
Questions
Send your questions to our top researchers at EpiScientist@invitrogen.com

