- Desalted and purified by gel filtration
- Assayed for function by PCR amplification
- Provided in 2 µg quantity
T7: 5´- TAATACGACTCACTATAGGG- 3´
| Form: |
Lyophilized |
| Mass: |
2 µg |
| Quantity: |
327 picomole |
| Primer Type: |
T7 Primers |
| Product Size: |
2 µg |
| Purification: |
Gel-Purified |
| Primer Length: |
20 -mer |
| Primer Sequence: |
5´d[TAATACGACTCACTATAGGG]3´ |
| Shipping Condition: |
Room Temperature |
| Regulatory Statement: |
For Research Use Only. Not for use in diagnostic procedures. |
Primer are supplied lyophilized in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA. Store at -20°C. Guaranteed stable for 6 months when properly stored.
Note: Use lot number only (e.g., "K18126").
Search unsuccessful? Request a COA
Order SupportContact Order & Web Support, Search FAQs, View Order History and Track Your Order | Product SupportContact a Technical Application Scientist, Search Product Documents & FAQs and Instrument Maintenance & Repair Requests |